<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec id="j_jvetres-2022-0004_s_005">
<h3>Introduction</h3>
<p>Porcine circovirus 4 (PCV4) was first discovered in 2019 in a herd of pigs with porcine respiratory disease, dermatitis and nephropathy syndrome in Hunan Province, China. It has subsequently been detected in other provinces and in South Korea. In consideration of the potential of the virus to cause an epidemic, rapid, sensitive, and specific detection of PCV4 is needed, as is the facilitation of further epidemiological research through elucidation of the whole genome of PCV4. This study had those two aims.</p></sec>
<sec id="j_jvetres-2022-0004_s_006">
<h3>Material and Methods</h3>
<p>Fifty-five blood samples, two pig tissue samples, nine saliva swabs and one semen sample which all originated from Sichuan province pig farms were analysed. The virus’ genome of 1,770 bp was synthesised artificially based on a Chinese reference strain and primers and probes for the <italic>ORF2</italic> gene were designed. Then, the amplified target fragment was cloned into the pMD19-T vector and a series of diluted recombinant plasmids were used to generate a standard curve. An optimised real-time TaqMan PCR method was established.</p></sec>
<sec id="j_jvetres-2022-0004_s_007">
<h3>Results</h3>
<p>The results of this study showed that the established method is specific for PCV4 but not for other viruses, and has amplification efficiency of 99.6%, a regression squared value (R<sup>2</sup>) of 1.000 and a detection limit of 2.2×10 DNA copies. This method was shown to be analytically specific and sensitive with a low intra- and inter-assay coefficient of variation (&lt;1.67 %). Of a total of 67 clinical samples tested using the established method, three were shown to be positive (4%).</p></sec>
<sec id="j_jvetres-2022-0004_s_008">
<h3>Conclusion</h3>
<p>This study confirms the existence of PCV4 in Sichuan and provides a promising alternative tool for rapid detection of PCV4.</p></sec>
</abstract>

Introduction
Porcine circovirus 4 (PCV4) was first discovered in 2019 in a herd of pigs with porcine respiratory disease, dermatitis and nephropathy syndrome in Hunan Province, China. It has subsequently been detected in other provinces and in South Korea. In consideration of the potential of the virus to cause an epidemic, rapid, sensitive, and specific detection of PCV4 is needed, as is the facilitation of further epidemiological research through elucidation of the whole genome of PCV4. This study had those two aims.

Material and Methods
Fifty-five blood samples, two pig tissue samples, nine saliva swabs and one semen sample which all originated from Sichuan province pig farms were analysed. The virus’ genome of 1,770 bp was synthesised artificially based on a Chinese reference strain and primers and probes for the ORF2 gene were designed. Then, the amplified target fragment was cloned into the pMD19-T vector and a series of diluted recombinant plasmids were used to generate a standard curve. An optimised real-time TaqMan PCR method was established.

Results
The results of this study showed that the established method is specific for PCV4 but not for other viruses, and has amplification efficiency of 99.6%, a regression squared value (R2) of 1.000 and a detection limit of 2.2×10 DNA copies. This method was shown to be analytically specific and sensitive with a low intra- and inter-assay coefficient of variation (<1.67 %). Of a total of 67 clinical samples tested using the established method, three were shown to be positive (4%).

Conclusion
This study confirms the existence of PCV4 in Sichuan and provides a promising alternative tool for rapid detection of PCV4.

Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Introduction
Porcine circovirus 4 (PCV4) was first discovered in 2019 in a herd of pigs with porcine respiratory disease, dermatitis and nephropathy syndrome...

Positive plasmid concentration	Intra-assay		Inter-assay
(copies/μL)	Ct (mean ± SD)	CV %	Ct (mean ± SD)	CV %
2.20 × 10⁵	18.15 ± 0.22	1.21	18.14 ± 0.25	1.38
2.20 × 10⁴	21.48 ± 0.14	0.65	21.49 ± 0.18	0.84
2.20 × 10³	24.98 ± 0.16	0.64	24.92 ± 0.28	1.12
2.20 × 10²	28.56 ± 0.36	1.26	28.53 ± 0.48	1.68

Primer	Nucleotide sequence (5ʹ–3ʹ)	Nt position
PCV4-F	AATCTCACTGTCCACACCTG	1105–1124
PCV4-R	CAAAACCCCAGGACCCATC	1267–1249
PCV4-probe	FAM-ACCCACACCCTCCACTTCCAGC-BHQ1

Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4

Pubblicato online: 25 mar 2022

Pagine: 29 - 33

Ricevuto: 01 lug 2021

Accettato: 11 gen 2022

DOI: https://doi.org/10.2478/jvetres-2022-0004

Parole chiave
porcine circovirus 4, real-time TaqMan PCR, detection method.

© 2022 W. Chen et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Fig. 2

Repeatability test of qPCR

Nucleotide sequences of PCV4 primers and PCV4 probe

Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4

Pubblicato online: 25 mar 2022

Pagine: 29 - 33

Ricevuto: 01 lug 2021

Accettato: 11 gen 2022

DOI: https://doi.org/10.2478/jvetres-2022-0004

Parole chiaveporcine circovirus 4, real-time TaqMan PCR, detection method.

© 2022 W. Chen et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Fig. 2

Repeatability test of qPCR

Nucleotide sequences of PCV4 primers and PCV4 probe

Parole chiave
porcine circovirus 4, real-time TaqMan PCR, detection method.