Accès libre

Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4

Wanting Chen

Wanting Chen

  • Chengdu Agricultural CollegeChengdu, China
  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Chen, Wanting
, 
Dike Jiang

Dike Jiang

  • Chengdu Agricultural CollegeChengdu, China
  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Jiang, Dike
, 
Lu Xiao

Lu Xiao

Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Xiao, Lu
, 
Pengfei Zhang

Pengfei Zhang

  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Zhang, Pengfei
, 
Yan Luo

Yan Luo

  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Luo, Yan
, 
Zexiao Yang

Zexiao Yang

  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Yang, Zexiao
, 
Xueping Yao

Xueping Yao

  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Yao, Xueping
, 
Yin Wang

Yin Wang

  • College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
  • Key Laboratory of Animal Diseases and Human Health of Sichuan Province, College of Veterinary Medicine, Sichuan Agricultural UniversityChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Wang, Yin
 et 
Xulong Wu

Xulong Wu

Chengdu Agricultural CollegeChengdu, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Wu, Xulong
  
25 mars 2022
Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Publié en ligne: 25 mars 2022
Pages: 29 - 33
Reçu: 01 juil. 2021
Accepté: 11 janv. 2022
DOI: https://doi.org/10.2478/jvetres-2022-0004
Mots clés
© 2022 W. Chen et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Standard curve of PCV4 real-time PCR for serially diluted pMD19T-PCV4 recombinant plasmids. Mean threshold cycle (Ct) values from three replicates (y-axis) are plotted versus logarithmic concentrations of plasmid copies (x-axis)
Standard curve of PCV4 real-time PCR for serially diluted pMD19T-PCV4 recombinant plasmids. Mean threshold cycle (Ct) values from three replicates (y-axis) are plotted versus logarithmic concentrations of plasmid copies (x-axis)

Fig. 2

Sensitivity analysis of the TaqMan real-time PCR for PCV4. RFU – relative fluorescence units; 1–8 – 2.2 × 108 copies/μL–2.2 × 101 copies/μL. The lowest copy number detected by qPCR was 2.2 × 101 copies/μL
Sensitivity analysis of the TaqMan real-time PCR for PCV4. RFU – relative fluorescence units; 1–8 – 2.2 × 108 copies/μL–2.2 × 101 copies/μL. The lowest copy number detected by qPCR was 2.2 × 101 copies/μL

Repeatability test of qPCR

Positive plasmid concentration Intra-assay Inter-assay
(copies/μL) Ct (mean ± SD) CV % Ct (mean ± SD) CV %
2.20 × 105 18.15 ± 0.22 1.21 18.14 ± 0.25 1.38
2.20 × 104 21.48 ± 0.14 0.65 21.49 ± 0.18 0.84
2.20 × 103 24.98 ± 0.16 0.64 24.92 ± 0.28 1.12
2.20 × 102 28.56 ± 0.36 1.26 28.53 ± 0.48 1.68

Nucleotide sequences of PCV4 primers and PCV4 probe

Primer Nucleotide sequence (5ʹ–3ʹ) Nt position
PCV4-F AATCTCACTGTCCACACCTG 1105–1124
PCV4-R CAAAACCCCAGGACCCATC 1267–1249
PCV4-probe FAM-ACCCACACCCTCCACTTCCAGC-BHQ1
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Sciences de la vie, Biologie moléculaire, Microbiologie et virologie, Sciences de la vie, autres, Médecine, Médecine vétérinaire
RSS Feed de la revue