Otwarty dostęp

Development of a real-time TaqMan PCR assay for the detection of porcine circovirus 4

, , , , , , ,  oraz   
25 mar 2022

Zacytuj
Pobierz okładkę

Fig. 1

Standard curve of PCV4 real-time PCR for serially diluted pMD19T-PCV4 recombinant plasmids. Mean threshold cycle (Ct) values from three replicates (y-axis) are plotted versus logarithmic concentrations of plasmid copies (x-axis)
Standard curve of PCV4 real-time PCR for serially diluted pMD19T-PCV4 recombinant plasmids. Mean threshold cycle (Ct) values from three replicates (y-axis) are plotted versus logarithmic concentrations of plasmid copies (x-axis)

Fig. 2

Sensitivity analysis of the TaqMan real-time PCR for PCV4. RFU – relative fluorescence units; 1–8 – 2.2 × 108 copies/μL–2.2 × 101 copies/μL. The lowest copy number detected by qPCR was 2.2 × 101 copies/μL
Sensitivity analysis of the TaqMan real-time PCR for PCV4. RFU – relative fluorescence units; 1–8 – 2.2 × 108 copies/μL–2.2 × 101 copies/μL. The lowest copy number detected by qPCR was 2.2 × 101 copies/μL

Repeatability test of qPCR

Positive plasmid concentration Intra-assay Inter-assay
(copies/μL) Ct (mean ± SD) CV % Ct (mean ± SD) CV %
2.20 × 105 18.15 ± 0.22 1.21 18.14 ± 0.25 1.38
2.20 × 104 21.48 ± 0.14 0.65 21.49 ± 0.18 0.84
2.20 × 103 24.98 ± 0.16 0.64 24.92 ± 0.28 1.12
2.20 × 102 28.56 ± 0.36 1.26 28.53 ± 0.48 1.68

Nucleotide sequences of PCV4 primers and PCV4 probe

Primer Nucleotide sequence (5ʹ–3ʹ) Nt position
PCV4-F AATCTCACTGTCCACACCTG 1105–1124
PCV4-R CAAAACCCCAGGACCCATC 1267–1249
PCV4-probe FAM-ACCCACACCCTCCACTTCCAGC-BHQ1
Język:
Angielski
Częstotliwość wydawania:
4 razy w roku
Dziedziny czasopisma:
Nauki biologiczne, Biologia molekularna, Mikrobiologia i wirusologia, Nauki biologiczne, inne, Medycyna, Weterynaria