<abstract xmlns="http://www.w3.org/1999/xhtml"><p>ADSCs are readily accessible and widely available. Isolated through a minimally invasive procedure from adipose depots, they can be found at diverse body location, where they served various functions, including energy homeostasis. They can be obtained upon surgeries from otherwise waste tissues, like after excision of fat tissue or liposuction. In addition, due to the possibility to isolate many ADSCs, in vitro proliferation can be performed in a short time period, resulting in cells showing more predictable results[<xref ref-type="bibr" rid="j_acb-2020-0020_ref_001_w2aab3b7c11b1b6b1ab2b2b1Aa">1</xref>]. For this study ADSCs were obtained from waste material following routing sterilization procedures of dogs. This study aimed to analyse the expression of MSC specific markers before and after in vitro differentiation of ASCs. Three positive and three negative markers were analysed, <italic>CD105, CD73, CD90, CD34</italic>, <italic>CD14</italic> and <italic>CD45</italic>. There were significant differences detected in the expression of all of the genes, with most of them exhibiting notable downregulation. The only exception, <italic>CD14</italic> showed major upregulation after the process of differentiation. These changes confirm the success of differentiation, as well as suggest that this process significantly lowers the stem-like ability of ASCs. This knowledge should serve as a reference for further molecular and clinical studies, possibly aiding the understanding of the internal mechanisms governing the differentiation and stemness of ASCs, to enable their widespread and safe application in regenerative medicine.</p><p><bold>Running title</bold>: Mesenchymal markers during ASC osteogenic differentiation</p></abstract>

ADSCs are readily accessible and widely available. Isolated through a minimally invasive procedure from adipose depots, they can be found at diverse body location, where they served various functions, including energy homeostasis. They can be obtained upon surgeries from otherwise waste tissues, like after excision of fat tissue or liposuction. In addition, due to the possibility to isolate many ADSCs, in vitro proliferation can be performed in a short time period, resulting in cells showing more predictable results[1]. For this study ADSCs were obtained from waste material following routing sterilization procedures of dogs. This study aimed to analyse the expression of MSC specific markers before and after in vitro differentiation of ASCs. Three positive and three negative markers were analysed, CD105, CD73, CD90, CD34, CD14 and CD45. There were significant differences detected in the expression of all of the genes, with most of them exhibiting notable downregulation. The only exception, CD14 showed major upregulation after the process of differentiation. These changes confirm the success of differentiation, as well as suggest that this process significantly lowers the stem-like ability of ASCs. This knowledge should serve as a reference for further molecular and clinical studies, possibly aiding the understanding of the internal mechanisms governing the differentiation and stemness of ASCs, to enable their widespread and safe application in regenerative medicine.Running title: Mesenchymal markers during ASC osteogenic differentiation

The influence of osteogenic differentiation on the stem-like properties of adipose derived stem cells – an RT-qPCR study

Medical Journal of Cell Biology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

ADSCs are readily accessible and widely available. Isolated through a minimally invasive procedure from adipose depots, they can be found at diverse body...

GENE NAME	FORWARD PRIMER	REVERSE PRIMER
CD105	CTCAGGTCCCCAATGCTACC	GGTTGAAGGCCAGGTAGAGT
CD73	CCCATTGACGAACGGAACAA	TATACCACGTGAATTCCGCC
CD14	CACTAGAGCCCTGCGAAGTA	CGACGGCAATCATACACTGG
CD34	ATGAGACCTCCAGCTGTGAG	AGGTCAGACTGGTGCTTTCT
CD90	CGAGAATGCTACCACCTTGC	AGCCGGAGTTCACATGTGTA
CD45	ACCTAGGCAAACATGTGAGGA	CTTCCAGATCAAAATTTCCACGA
HPRT	CCATCACATCGTAGCCCTC	ACTTTTATATCGCCCGTTGAC
ACTB	CCCTTGCCGCTCCGCCTTC	GCAGCAATATCGGTCATCCAT

The influence of osteogenic differentiation on the stem-like properties of adipose derived stem cells – an RT-qPCR study

Data publikacji: 31 gru 2020

Zakres stron: 158 - 163

Otrzymano: 21 paź 2020

Przyjęty: 03 gru 2020

DOI: https://doi.org/10.2478/acb-2020-0020

Słowa kluczowe
adipose, stem cells, differentiation, osteogenic, markers

© 2020 Rut Bryl, Claudia Dompe, Maurycy Jankowski, Katarzyna Stefańska, Afsaneh Golkar Narenji, Jakub Kulus, Magdalena Kulus, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Jędrzej M. Jaśkowski, Mariusz Kaczmarek, James N. Petitte, Paul Mozdziak, Paweł Antosik, Dorota Bukowska, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

The sequences of primers used in the analysis

The influence of osteogenic differentiation on the stem-like properties of adipose derived stem cells – an RT-qPCR study

Data publikacji: 31 gru 2020

Zakres stron: 158 - 163

Otrzymano: 21 paź 2020

Przyjęty: 03 gru 2020

DOI: https://doi.org/10.2478/acb-2020-0020

Słowa kluczoweadipose, stem cells, differentiation, osteogenic, markers

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

The sequences of primers used in the analysis

Słowa kluczowe
adipose, stem cells, differentiation, osteogenic, markers