Accès libre

The influence of osteogenic differentiation on the stem-like properties of adipose derived stem cells – an RT-qPCR study

Rut Bryl

Rut Bryl

Department of Anatomy, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Bryl, Rut
, 
Claudia Dompe

Claudia Dompe

School of Medicine, Medical Sciences and Nutrition, University of AberdeenAberdeen, UK
Recherchez cet auteur sur
Sciendo|Google Scholar
Dompe, Claudia
, 
Maurycy Jankowski

Maurycy Jankowski

Department of Anatomy, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Jankowski, Maurycy
, 
Katarzyna Stefańska

Katarzyna Stefańska

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Stefańska, Katarzyna
, 
Afsaneh Golkar Narenji

Afsaneh Golkar Narenji

Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, NC, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Narenji, Afsaneh Golkar
, 
Jakub Kulus

Jakub Kulus

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToru, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Kulus, Jakub
, 
Magdalena Kulus

Magdalena Kulus

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Kulus, Magdalena
, 
Maria Wieczorkiewicz

Maria Wieczorkiewicz

Department of Basic and Preclinical Sciences, Institute of Veterinary Medicine, Faculty of Biological and Veterinary Sciences, Nicolaus Copernicus University in ToruńToruń, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Wieczorkiewicz, Maria
, 
Grzegorz Wąsiatycz

Grzegorz Wąsiatycz

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Wąsiatycz, Grzegorz
, 
Jędrzej M. Jaśkowski

Jędrzej M. Jaśkowski

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToru, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Jaśkowski, Jędrzej M.
, 
Mariusz Kaczmarek

Mariusz Kaczmarek

Department of Cancer Immunology, Poznan University of Medical SciencesPoznań, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Kaczmarek, Mariusz
, 
James N. Petitte

James N. Petitte

Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, NC, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Petitte, James N.
, 
Paul Mozdziak

Paul Mozdziak

  • Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, NC, USA
  • Physiology Graduate Program, North Carolina State UniversityRaleigh, NC, USA
Recherchez cet auteur sur
Sciendo|Google Scholar
Mozdziak, Paul
, 
Paweł Antosik

Paweł Antosik

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Antosik, Paweł
 et 
Dorota Bukowska

Dorota Bukowska

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToru, Poland
Recherchez cet auteur sur
Sciendo|Google Scholar
Bukowska, Dorota
  
31 déc. 2020
The influence of osteogenic differentiation on the stem-like properties of adipose derived stem cells – an RT-qPCR study's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Publié en ligne: 31 déc. 2020
Pages: 158 - 163
Reçu: 21 oct. 2020
Accepté: 03 déc. 2020
DOI: https://doi.org/10.2478/acb-2020-0020
Mots clés
© 2020 Rut Bryl, Claudia Dompe, Maurycy Jankowski, Katarzyna Stefańska, Afsaneh Golkar Narenji, Jakub Kulus, Magdalena Kulus, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Jędrzej M. Jaśkowski, Mariusz Kaczmarek, James N. Petitte, Paul Mozdziak, Paweł Antosik, Dorota Bukowska, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

The results of the RT-qPCR analysis of the change in expression of ASC specific markers before and after osteogenic differentiation. All data was presented as a log2 of fold change
The results of the RT-qPCR analysis of the change in expression of ASC specific markers before and after osteogenic differentiation. All data was presented as a log2 of fold change

The sequences of primers used in the analysis

GENE NAMEFORWARD PRIMERREVERSE PRIMER
CD105CTCAGGTCCCCAATGCTACCGGTTGAAGGCCAGGTAGAGT
CD73CCCATTGACGAACGGAACAATATACCACGTGAATTCCGCC
CD14CACTAGAGCCCTGCGAAGTACGACGGCAATCATACACTGG
CD34ATGAGACCTCCAGCTGTGAGAGGTCAGACTGGTGCTTTCT
CD90CGAGAATGCTACCACCTTGCAGCCGGAGTTCACATGTGTA
CD45ACCTAGGCAAACATGTGAGGACTTCCAGATCAAAATTTCCACGA
HPRTCCATCACATCGTAGCCCTCACTTTTATATCGCCCGTTGAC
ACTBCCCTTGCCGCTCCGCCTTCGCAGCAATATCGGTCATCCAT
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Sciences de la vie, Biologie moléculaire, Biochimie
RSS Feed de la revue