Acceso abierto

Development and Evaluation of a Rapid GII Norovirus Detection Method Based on CRISPR-Cas12a

Xinyi Hu
Xinyi Hu
, 
Pei He
Pei He
, 
Tong Jiang
Tong Jiang
 y 
Jilu Shen
Jilu Shen
   | 04 mar 2024
Polish Journal of Microbiology's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Article Category: ORIGINAL PAPER
Publicado en línea: 04 mar 2024
Páginas: 89 - 97
Recibido: 28 oct 2023
Aceptado: 22 ene 2024
DOI: https://doi.org/10.33073/pjm-2024-009
Palabras clave
© 2024 Xinyi Hu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Detection principle of RPA-Cas12a-fluorescence analysis and RPA-Cas12a-immunochromatography detection method. A) RPA-Cas12a method detection process; B) principle of Immunochromatography Flow Strip. C) the schematic diagram for judging the results of immunochromatography flow strips
Detection principle of RPA-Cas12a-fluorescence analysis and RPA-Cas12a-immunochromatography detection method. A) RPA-Cas12a method detection process; B) principle of Immunochromatography Flow Strip. C) the schematic diagram for judging the results of immunochromatography flow strips

Fig. 2.

RPA amplified fragments and design results of crRNA.
RPA amplified fragments and design results of crRNA.

Fig. 3.

Verification of sensitivity and specificity of the RPA-Cas12a-fluorometric and RPA-Cas12a-immunochromatographic assays. A) Sensitivity curves of different concentrations of norovirus positive quality control products amplified by RPA; B) specificity of RPA-Cas12a-fluorometric assay; C) RPA-Cas12a-immunochromatographic results of different concentrations of Norovirus; D) specificity of RPA-Cas12a-immunochromatographic assay
Verification of sensitivity and specificity of the RPA-Cas12a-fluorometric and RPA-Cas12a-immunochromatographic assays. A) Sensitivity curves of different concentrations of norovirus positive quality control products amplified by RPA; B) specificity of RPA-Cas12a-fluorometric assay; C) RPA-Cas12a-immunochromatographic results of different concentrations of Norovirus; D) specificity of RPA-Cas12a-immunochromatographic assay

Fig. 4.

Detection of GII norovirus in clinical samples based on CRISPR-Cas12a. A, B, C) Positive results of RPA-Cas12a-fluorescence assay of 24 samples; D) positive results of RPA-Cas12a-immunochromatographic assay of 24 samples; E) negative results of RPA-Cas12a-immunochromatographic assay of 11 samples; F, G) qPCR results of 24 positive samples
Detection of GII norovirus in clinical samples based on CRISPR-Cas12a. A, B, C) Positive results of RPA-Cas12a-fluorescence assay of 24 samples; D) positive results of RPA-Cas12a-immunochromatographic assay of 24 samples; E) negative results of RPA-Cas12a-immunochromatographic assay of 11 samples; F, G) qPCR results of 24 positive samples

Comparison between RPA-cas12a method and qPCR.

RPA-Cas12a Quantitative Real-Time PCR Total
+ −
+ 24 0 24
− 0 11 11
Total 24 11 35

Bacteria and viruses involved in this study.

Name Source of strains
Shigella flexneri CMCC(B)51572
Escherichia coli O157:H7 NCTC12900
Vibrio parahaemolyticus ATCC® 17802™
Salmonella Typhimurium Clinical isolates
Campylobacter jejuni ATCC® 33291™
Yersinia enterocolitica CMCC(B)50024
Human astrovirus Clinical isolates
Rotavirus ATCC® VR-2274™
Enteric adenovirus ATCC® VR-930™

Primers and crRNA sequences.

Oligonucleotide Sequence (5’–3’)
RPA forward primers CCTCTCTTCACGGACCCTCTTTCTACAGC
RPA reverse primers TTCATTCACAAAATTGGGAGCCAGATTGC
crRNA AGUGCCUGGGAGAAAGAUGUCGUUU
ssDNA reporters FAM-TTATTATT-BHQ1
FAM-TTATTATT-Biotin
eISSN:
2544-4646
Idioma:
Inglés
Calendario de la edición:
4 veces al año
Temas de la revista:
Life Sciences, Microbiology and Virology
RSS Feed de revista