Accès libre

Development and Evaluation of a Rapid GII Norovirus Detection Method Based on CRISPR-Cas12a

Xinyi Hu

Xinyi Hu

  • The First Affiliated Hospital of Anhui Medical UniversityHefei, China
  • Anhui Public Health Clinical CenterHefei, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Hu, Xinyi
, 
Pei He

Pei He

  • The First Affiliated Hospital of Anhui Medical UniversityHefei, China
  • Anhui Public Health Clinical CenterHefei, China
Recherchez cet auteur sur
Sciendo|Google Scholar
He, Pei
, 
Tong Jiang

Tong Jiang

  • The First Affiliated Hospital of Anhui Medical UniversityHefei, China
  • Anhui Public Health Clinical CenterHefei, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Jiang, Tong
 et 
Jilu Shen

Jilu Shen

  • The First Affiliated Hospital of Anhui Medical UniversityHefei, China
  • Anhui Public Health Clinical CenterHefei, China
Recherchez cet auteur sur
Sciendo|Google Scholar
Shen, Jilu
  
04 mars 2024
Development and Evaluation of a Rapid GII Norovirus Detection Method Based on CRISPR-Cas12a's Cover Image
À propos de cet article
Article précédent
Article suivant
Citez
Télécharger la couverture
Catégorie d'article: ORIGINAL PAPER
Publié en ligne: 04 mars 2024
Pages: 89 - 97
Reçu: 28 oct. 2023
Accepté: 22 janv. 2024
DOI: https://doi.org/10.33073/pjm-2024-009
Mots clés
© 2024 Xinyi Hu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Detection principle of RPA-Cas12a-fluorescence analysis and RPA-Cas12a-immunochromatography detection method. A) RPA-Cas12a method detection process; B) principle of Immunochromatography Flow Strip. C) the schematic diagram for judging the results of immunochromatography flow strips
Detection principle of RPA-Cas12a-fluorescence analysis and RPA-Cas12a-immunochromatography detection method. A) RPA-Cas12a method detection process; B) principle of Immunochromatography Flow Strip. C) the schematic diagram for judging the results of immunochromatography flow strips

Fig. 2.

RPA amplified fragments and design results of crRNA.
RPA amplified fragments and design results of crRNA.

Fig. 3.

Verification of sensitivity and specificity of the RPA-Cas12a-fluorometric and RPA-Cas12a-immunochromatographic assays. A) Sensitivity curves of different concentrations of norovirus positive quality control products amplified by RPA; B) specificity of RPA-Cas12a-fluorometric assay; C) RPA-Cas12a-immunochromatographic results of different concentrations of Norovirus; D) specificity of RPA-Cas12a-immunochromatographic assay
Verification of sensitivity and specificity of the RPA-Cas12a-fluorometric and RPA-Cas12a-immunochromatographic assays. A) Sensitivity curves of different concentrations of norovirus positive quality control products amplified by RPA; B) specificity of RPA-Cas12a-fluorometric assay; C) RPA-Cas12a-immunochromatographic results of different concentrations of Norovirus; D) specificity of RPA-Cas12a-immunochromatographic assay

Fig. 4.

Detection of GII norovirus in clinical samples based on CRISPR-Cas12a. A, B, C) Positive results of RPA-Cas12a-fluorescence assay of 24 samples; D) positive results of RPA-Cas12a-immunochromatographic assay of 24 samples; E) negative results of RPA-Cas12a-immunochromatographic assay of 11 samples; F, G) qPCR results of 24 positive samples
Detection of GII norovirus in clinical samples based on CRISPR-Cas12a. A, B, C) Positive results of RPA-Cas12a-fluorescence assay of 24 samples; D) positive results of RPA-Cas12a-immunochromatographic assay of 24 samples; E) negative results of RPA-Cas12a-immunochromatographic assay of 11 samples; F, G) qPCR results of 24 positive samples

Comparison between RPA-cas12a method and qPCR_

RPA-Cas12a Quantitative Real-Time PCR Total
+ −
+ 24 0 24
− 0 11 11
Total 24 11 35

Bacteria and viruses involved in this study_

Name Source of strains
Shigella flexneri CMCC(B)51572
Escherichia coli O157:H7 NCTC12900
Vibrio parahaemolyticus ATCC® 17802™
Salmonella Typhimurium Clinical isolates
Campylobacter jejuni ATCC® 33291™
Yersinia enterocolitica CMCC(B)50024
Human astrovirus Clinical isolates
Rotavirus ATCC® VR-2274™
Enteric adenovirus ATCC® VR-930™

Primers and crRNA sequences_

Oligonucleotide Sequence (5’–3’)
RPA forward primers CCTCTCTTCACGGACCCTCTTTCTACAGC
RPA reverse primers TTCATTCACAAAATTGGGAGCCAGATTGC
crRNA AGUGCCUGGGAGAAAGAUGUCGUUU
ssDNA reporters FAM-TTATTATT-BHQ1
FAM-TTATTATT-Biotin
Langue:
Anglais
Périodicité:
4 fois par an
Sujets de la revue:
Sciences de la vie, Microbiologie et virologie
RSS Feed de la revue