Open Access

Development and Evaluation of a Rapid GII Norovirus Detection Method Based on CRISPR-Cas12a

, ,  and   
Mar 04, 2024

Cite
Download Cover

Fig. 1.

Detection principle of RPA-Cas12a-fluorescence analysis and RPA-Cas12a-immunochromatography detection method.
A) RPA-Cas12a method detection process; B) principle of Immunochromatography Flow Strip. C) the schematic diagram for judging the results of immunochromatography flow strips
Detection principle of RPA-Cas12a-fluorescence analysis and RPA-Cas12a-immunochromatography detection method. A) RPA-Cas12a method detection process; B) principle of Immunochromatography Flow Strip. C) the schematic diagram for judging the results of immunochromatography flow strips

Fig. 2.

RPA amplified fragments and design results of crRNA.
RPA amplified fragments and design results of crRNA.

Fig. 3.

Verification of sensitivity and specificity of the RPA-Cas12a-fluorometric and RPA-Cas12a-immunochromatographic assays. A) Sensitivity curves of different concentrations of norovirus positive quality control products amplified by RPA; B) specificity of RPA-Cas12a-fluorometric assay; C) RPA-Cas12a-immunochromatographic results of different concentrations of Norovirus; D) specificity of RPA-Cas12a-immunochromatographic assay
Verification of sensitivity and specificity of the RPA-Cas12a-fluorometric and RPA-Cas12a-immunochromatographic assays. A) Sensitivity curves of different concentrations of norovirus positive quality control products amplified by RPA; B) specificity of RPA-Cas12a-fluorometric assay; C) RPA-Cas12a-immunochromatographic results of different concentrations of Norovirus; D) specificity of RPA-Cas12a-immunochromatographic assay

Fig. 4.

Detection of GII norovirus in clinical samples based on CRISPR-Cas12a.
A, B, C) Positive results of RPA-Cas12a-fluorescence assay of 24 samples; D) positive results of RPA-Cas12a-immunochromatographic assay of 24 samples; E) negative results of RPA-Cas12a-immunochromatographic assay of 11 samples; F, G) qPCR results of 24 positive samples
Detection of GII norovirus in clinical samples based on CRISPR-Cas12a. A, B, C) Positive results of RPA-Cas12a-fluorescence assay of 24 samples; D) positive results of RPA-Cas12a-immunochromatographic assay of 24 samples; E) negative results of RPA-Cas12a-immunochromatographic assay of 11 samples; F, G) qPCR results of 24 positive samples

Comparison between RPA-cas12a method and qPCR_

RPA-Cas12a Quantitative Real-Time PCR Total
+
+ 24 0 24
0 11 11
Total 24 11 35

Bacteria and viruses involved in this study_

Name Source of strains
Shigella flexneri CMCC(B)51572
Escherichia coli O157:H7 NCTC12900
Vibrio parahaemolyticus ATCC® 17802
Salmonella Typhimurium Clinical isolates
Campylobacter jejuni ATCC® 33291
Yersinia enterocolitica CMCC(B)50024
Human astrovirus Clinical isolates
Rotavirus ATCC® VR-2274
Enteric adenovirus ATCC® VR-930

Primers and crRNA sequences_

Oligonucleotide Sequence (5’–3’)
RPA forward primers CCTCTCTTCACGGACCCTCTTTCTACAGC
RPA reverse primers TTCATTCACAAAATTGGGAGCCAGATTGC
crRNA AGUGCCUGGGAGAAAGAUGUCGUUU
ssDNA reporters FAM-TTATTATT-BHQ1
FAM-TTATTATT-Biotin
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Microbiology and Virology