Prevalence of the bla CTX-M and bla TEM genes among extended-spectrum beta lactamase–producing Escherichia coli isolated from broiler chickens in Indonesia
, , , , , , , , oraz | 16 cze 2023
O artykule
Data publikacji: 16 cze 2023
Zakres stron: 179 - 186
Otrzymano: 11 sty 2023
Przyjęty: 19 kwi 2023
DOI: https://doi.org/10.2478/jvetres-2023-0025
Słowa kluczowe
© 2023 Hayyun Durrotul Faridah et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1.
Fig. 2.
Fig. 3.
Fig. 4.
Fig. 5.
Fig. 6.
The occurrences of E. coli in broiler cloacal swabs in Blitar district, East Java, Indonesia
| Subdistrict | Farm number | Sample size | |
|---|---|---|---|
| Ponggok | 5 | 28 | 28 (100%) |
| Garum | 5 | 25 | 25 (100%) |
| Selopuro | 7 | 36 | 36 (100%) |
| Selorejo | 5 | 26 | 26 (100%) |
| Total | 22 | 115 | 115 (100%) |
The extended-spectrum beta lactamase–producing E. coli harbouring blaCTX-M and blaTEM genes
| Subdistrict location | Encoding gene | |
| Ponggok | ||
| Total | 9/10; 9/34 (26.5%) | 4/10; 4/34 (11.8%) |
| Garum | ||
| Total | 4/4; 4/34 (11.8%) | 2/4; 2/34 (5.9%) |
| Selopuro | ||
| Total | 8/8; 8/34 (23.5%) | 4/8; 4/34 (11.8%) |
| Selorejo | ||
| Total | 11/12; 11/34 (32.4%) | 3/12; 3/34 (8.8%) |
| Overall total | 32/34 (94.1%) | 13/34 (38.2%) |
The list of primers used in this study
| Gene | Primer | Sequences | Amplicon (bp) | Annealing | References |
|---|---|---|---|---|---|
| Forward | CGC TTT GCG ATG TGC AG | 550 | 54°C | (27) | |
| Reverse | ACC GCG ATA TCG TTG GT | ||||
| Forward | ATAAAATTCTTGAAGACGAAA | 1,080 | 59°C | (18) | |
| Reverse | GACAGTTACCAATGCTTAATC |