Open Access

Prevalence of the blaCTX-M and blaTEM genes among extended-spectrum beta lactamase–producing Escherichia coli isolated from broiler chickens in Indonesia

Hayyun Durrotul Faridah

Hayyun Durrotul Faridah

Department of Biology, Faculty of Science and Technology, Universitas AirlanggaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Faridah, Hayyun Durrotul
, 
Freshindy Marissa Wibisono

Freshindy Marissa Wibisono

Department of Veterinary Disease and Public Health, Faculty of Veterinary Medicine, Universitas AirlanggaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Wibisono, Freshindy Marissa
, 
Freshinta Jellia Wibisono

Freshinta Jellia Wibisono

Department of Veterinary Public Health, Faculty of Veterinary Medicine, Universitas Wijaya KusumaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Wibisono, Freshinta Jellia
, 
Nabilatun Nisa

Nabilatun Nisa

Department of Biology, Faculty of Science and Technology, Universitas AirlanggaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Nisa, Nabilatun
, 
Fatimah Fatimah

Fatimah Fatimah

Department of Biology, Faculty of Science and Technology, Universitas AirlanggaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Fatimah, Fatimah
, 
Mustofa Helmi Effendi

Mustofa Helmi Effendi

Department of Veterinary Public Health, Faculty of Veterinary Medicine, Universitas AirlanggaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Effendi, Mustofa Helmi
, 
Emmanuel Nnabuike Ugbo

Emmanuel Nnabuike Ugbo

Department of Applied Microbiology, Faculty of Science, Ebonyi State UniversityAbakaliki, Nigeria
Search for this author on
Sciendo|Google Scholar
Ugbo, Emmanuel Nnabuike
, 
Aswin Rafif Khairullah

Aswin Rafif Khairullah

Department of Animal Husbandry, Faculty of Veterinary Medicine, Universitas AirlanggaSurabaya, Indonesia
Search for this author on
Sciendo|Google Scholar
Khairullah, Aswin Rafif
, 
Shendy Canadya Kurniawan

Shendy Canadya Kurniawan

Department of Animal Sciences, Specialisation in Molecule, Cell and Organ Functioning, Wageningen University and ResearchWageningen, Netherlands
Search for this author on
Sciendo|Google Scholar
Kurniawan, Shendy Canadya
 and 
Otto Sahat Martua Silaen

Otto Sahat Martua Silaen

Department of Biomedical Science, Faculty of Medicine, Universitas IndonesiaJakarta, Indonesia
Search for this author on
Sciendo|Google Scholar
Silaen, Otto Sahat Martua
  
Jun 16, 2023
Prevalence of the blaCTX-M and blaTEM genes among extended-spectrum beta lactamase–producing Escherichia coli isolated from broiler chickens in Indonesia's Cover Image
About this article
Previous Article
Next Article
Cite
Download Cover
Published Online: Jun 16, 2023
Page range: 179 - 186
Received: Jan 11, 2023
Accepted: Apr 19, 2023
DOI: https://doi.org/10.2478/jvetres-2023-0025
Keywords
© 2023 Hayyun Durrotul Faridah et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1.

Appearance of E. coli on eosin methylene blue agar media
Appearance of E. coli on eosin methylene blue agar media

Fig. 2.

The Gram staining appearance of E. coli in microscopy (1000×)
The Gram staining appearance of E. coli in microscopy (1000×)

Fig. 3.

Double-disc synergy test showing the keyhole effect of extended-spectrum beta lactamase–producing E. coli CTX – cefotaxime; AMC – amoxicillin/clavulanic acid; CAZ – ceftazidime
Double-disc synergy test showing the keyhole effect of extended-spectrum beta lactamase–producing E. coli CTX – cefotaxime; AMC – amoxicillin/clavulanic acid; CAZ – ceftazidime

Fig. 4.

Distribution of extended-spectrum beta lactamase (ESBL)-producing E. coli from broilers in East Java Province, Indonesia
Distribution of extended-spectrum beta lactamase (ESBL)-producing E. coli from broilers in East Java Province, Indonesia

Fig. 5.

Gel picture showing the presence of the blaTEM gene in extended-spectrum beta lactamase–producing E. coli bp - base pairs
Gel picture showing the presence of the blaTEM gene in extended-spectrum beta lactamase–producing E. coli bp - base pairs

Fig. 6.

Gel picture showing the presence of the blaCTX-M gene in extended-spectrum beta lactamase–producing E. coli bp – base pairs
Gel picture showing the presence of the blaCTX-M gene in extended-spectrum beta lactamase–producing E. coli bp – base pairs

The occurrences of E_ coli in broiler cloacal swabs in Blitar district, East Java, Indonesia

Subdistrict Farm number Sample size E. coli isolates
Ponggok 5 28 28 (100%)
Garum 5 25 25 (100%)
Selopuro 7 36 36 (100%)
Selorejo 5 26 26 (100%)
Total 22 115 115 (100%)

The extended-spectrum beta lactamase–producing E_ coli harbouring blaCTX-M and blaTEM genes

Subdistrict location Encoding gene
blaCTX-M blaTEM
Ponggok + −
− −
+ +
+ +
+ −
+ +
+ −
+ +
+ −
+ −
Total 9/10; 9/34 (26.5%) 4/10; 4/34 (11.8%)
Garum + −
+ −
+ +
+ +
Total 4/4; 4/34 (11.8%) 2/4; 2/34 (5.9%)
Selopuro + −
+ +
+ −
+ +
+ +
+ −
+ +
+ −
Total 8/8; 8/34 (23.5%) 4/8; 4/34 (11.8%)
Selorejo + +
+ −
+ −
+ −
+ −
+ +
+ −
+ −
+ −
− +
+ −
+ −
Total 11/12; 11/34 (32.4%) 3/12; 3/34 (8.8%)
Overall total 32/34 (94.1%) 13/34 (38.2%)

The list of primers used in this study

Gene Primer Sequences Amplicon (bp) Annealing References
blaCTX-M Forward CGC TTT GCG ATG TGC AG 550 54°C (27)
Reverse ACC GCG ATA TCG TTG GT
blaTEM Forward ATAAAATTCTTGAAGACGAAA 1,080 59°C (18)
Reverse GACAGTTACCAATGCTTAATC
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, Life Sciences, other, Medicine, Veterinary Medicine
Journal RSS Feed