Zitieren

Fig. 1.

Appearance of E. coli on eosin methylene blue agar media
Appearance of E. coli on eosin methylene blue agar media

Fig. 2.

The Gram staining appearance of E. coli in microscopy (1000×)
The Gram staining appearance of E. coli in microscopy (1000×)

Fig. 3.

Double-disc synergy test showing the keyhole effect of extended-spectrum beta lactamase–producing E. coli CTX – cefotaxime; AMC – amoxicillin/clavulanic acid; CAZ – ceftazidime
Double-disc synergy test showing the keyhole effect of extended-spectrum beta lactamase–producing E. coli CTX – cefotaxime; AMC – amoxicillin/clavulanic acid; CAZ – ceftazidime

Fig. 4.

Distribution of extended-spectrum beta lactamase (ESBL)-producing E. coli from broilers in East Java Province, Indonesia
Distribution of extended-spectrum beta lactamase (ESBL)-producing E. coli from broilers in East Java Province, Indonesia

Fig. 5.

Gel picture showing the presence of the blaTEM gene in extended-spectrum beta lactamase–producing E. coli bp - base pairs
Gel picture showing the presence of the blaTEM gene in extended-spectrum beta lactamase–producing E. coli bp - base pairs

Fig. 6.

Gel picture showing the presence of the blaCTX-M gene in extended-spectrum beta lactamase–producing E. coli bp – base pairs
Gel picture showing the presence of the blaCTX-M gene in extended-spectrum beta lactamase–producing E. coli bp – base pairs

The occurrences of E. coli in broiler cloacal swabs in Blitar district, East Java, Indonesia

Subdistrict Farm number Sample size E. coli isolates
Ponggok 5 28 28 (100%)
Garum 5 25 25 (100%)
Selopuro 7 36 36 (100%)
Selorejo 5 26 26 (100%)
Total 22 115 115 (100%)

The extended-spectrum beta lactamase–producing E. coli harbouring blaCTX-M and blaTEM genes

Subdistrict location Encoding gene
blaCTX-M blaTEM
Ponggok +
+ +
+ +
+
+ +
+
+ +
+
+
Total 9/10; 9/34 (26.5%) 4/10; 4/34 (11.8%)
Garum +
+
+ +
+ +
Total 4/4; 4/34 (11.8%) 2/4; 2/34 (5.9%)
Selopuro +
+ +
+
+ +
+ +
+
+ +
+
Total 8/8; 8/34 (23.5%) 4/8; 4/34 (11.8%)
Selorejo + +
+
+
+
+
+ +
+
+
+
+
+
+
Total 11/12; 11/34 (32.4%) 3/12; 3/34 (8.8%)
Overall total 32/34 (94.1%) 13/34 (38.2%)

The list of primers used in this study

Gene Primer Sequences Amplicon (bp) Annealing References
blaCTX-M Forward CGC TTT GCG ATG TGC AG 550 54°C (27)
Reverse ACC GCG ATA TCG TTG GT
blaTEM Forward ATAAAATTCTTGAAGACGAAA 1,080 59°C (18)
Reverse GACAGTTACCAATGCTTAATC
eISSN:
2450-8608
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Molekularbiologie, Mikrobiologie und Virologie, andere, Medizin, Veterinärmedizin