<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec id="j_jvetres-2020-0021_s_005">
<h3>Introduction</h3>
<p>The aim of this study was to present two outbreaks of bovine abortion due to <italic>Leptospira</italic> infection in cattle herds located in the northern part of Sicily (Italy). The animals were positive for <italic>Leptospira interrogans</italic> serogroup Sejroe serovar Hardjo in a microscopic agglutination test (MAT).</p></sec>
<sec id="j_jvetres-2020-0021_s_006">
<h3>Material and Methods</h3>
<p>A total of 23 Charolaise cows (farm A) and 75 Limousine bulls and Cinisara and Modicana cows (farm B) were enrolled in this study. The blood samples were collected from all subjects at the following time points: before a cycle of intramuscular treatment with oxytetracycline dihydrate (T0), after 5–6 weeks from the treatment (T1), and every 10 weeks until seronegativisation (T2 in Farm A and T3 in Farm B). A serological test (MAT) was used for the diagnosis of leptospirosis.</p></sec>
<sec id="j_jvetres-2020-0021_s_007">
<h3>Results</h3>
<p>Two samples from farm A (2/23) and 29 samples from farm B (29/75) were positive to <italic>Leptospira interrogans</italic>, serogroup Sejroe, serovar Hardjo in the MAT. <italic>Leptospira</italic> spp. DNA was detected by real-time PCR in the urine sample of one positive cow on farm A, and in placenta and brain samples belonging to one aborted foetus on farm B.</p></sec>
<sec id="j_jvetres-2020-0021_s_008">
<h3>Conclusion</h3>
<p>It is important to use serological and molecular diagnostic techniques complementarily to identify infected individuals.</p></sec></abstract>

Introduction
The aim of this study was to present two outbreaks of bovine abortion due to Leptospira infection in cattle herds located in the northern part of Sicily (Italy). The animals were positive for Leptospira interrogans serogroup Sejroe serovar Hardjo in a microscopic agglutination test (MAT).

Material and Methods
A total of 23 Charolaise cows (farm A) and 75 Limousine bulls and Cinisara and Modicana cows (farm B) were enrolled in this study. The blood samples were collected from all subjects at the following time points: before a cycle of intramuscular treatment with oxytetracycline dihydrate (T0), after 5–6 weeks from the treatment (T1), and every 10 weeks until seronegativisation (T2 in Farm A and T3 in Farm B). A serological test (MAT) was used for the diagnosis of leptospirosis.

Results
Two samples from farm A (2/23) and 29 samples from farm B (29/75) were positive to Leptospira interrogans, serogroup Sejroe, serovar Hardjo in the MAT. Leptospira spp. DNA was detected by real-time PCR in the urine sample of one positive cow on farm A, and in placenta and brain samples belonging to one aborted foetus on farm B.

Conclusion
It is important to use serological and molecular diagnostic techniques complementarily to identify infected individuals.

<italic>Leptospira interrogans</italic> serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

 serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)

Introduction
The aim of this study was to present two outbreaks of bovine abortion due to Leptospira infection in cattle herds located in the northern part of...

Oligonucleotide	Sequence 5′–3′
Primer F	GGTCTTTACACAATTTCTTTCACT

Primer R	TGGGAAAAGCAGACCAACAGA

Probe	AAGTGAAAGGATCTTTCGTTGTTGC

Positive samples	Antibody titre
(n = 75)	T0	T1	T2	T3
1	1,600	800	800	<100

2	100	100	<100*	<100

3	1,600	3,200	1,600	<100

4	800	800	400	<100

5	100	100	<100*	<100

6	400	800	800	<100

7	100	200	<100*	<100

8	100	100	<100*	<100

9	200	200	<100*	<100

10	100	100	<100*	<100

11	800	400	400	<100

12	800	800	<100*	<100

13	1,600	800	400	<100

14	400	800	400	<100

15	100	100	<100*	<100

16	800	800	800	<100

17	800	1,600	1,600	<100

18	400	200	<100*	<100

19	1,600	1,600	800	<100

20	200	200	200	<100

21	100	200	<100*	<100

22	200	200	200	<100

23	800	400	200	<100

24	1,600	1,600	1,600	<100

25	3,200	3,200	1,600	<100

26	800	800	400	<100

27	800	800	800	<100

28	200	200	200	<100

29	800	800	400	<100

30	<100*	100**	<100*	<100

31	<100*	200**	200	<100

Positive samples (n = 23)	Antibody titre T0	Antibody titre T1	Antibody titre T2
1	400	200	<100*

2	400	<100*	<100*

Leptospira interrogans serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)

Data publikacji: 24 mar 2020

Zakres stron: 73 - 78

Otrzymano: 04 lip 2019

Przyjęty: 02 mar 2020

DOI: https://doi.org/10.2478/jvetres-2020-0021

Słowa kluczowe
cattle, leptospirosis, microscopic agglutination test, PCR, zoonosis

© 2020 F. Grippi et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Nucleotide sequences of primers and hydrolysis probe to amplification of lipL32 gene

Positive serum samples of cows on farm B by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 75). * <100 negative samples. ** New positive samples found at T1

Serum samples of cows on the farm A by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 23). * <100 negative samples

Leptospira interrogans serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)

Data publikacji: 24 mar 2020

Zakres stron: 73 - 78

Otrzymano: 04 lip 2019

Przyjęty: 02 mar 2020

DOI: https://doi.org/10.2478/jvetres-2020-0021

Słowa kluczowecattle, leptospirosis, microscopic agglutination test, PCR, zoonosis

© 2020 F. Grippi et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Nucleotide sequences of primers and hydrolysis probe to amplification of lipL32 gene

Positive serum samples of cows on farm B by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 75). * <100 negative samples. ** New positive samples found at T1

Serum samples of cows on the farm A by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 23). * <100 negative samples

Słowa kluczowe
cattle, leptospirosis, microscopic agglutination test, PCR, zoonosis