Leptospira interrogans serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)
, , , , , , e
24 mar 2020
INFORMAZIONI SU QUESTO ARTICOLO
Pubblicato online: 24 mar 2020
Pagine: 73 - 78
Ricevuto: 04 lug 2019
Accettato: 02 mar 2020
DOI: https://doi.org/10.2478/jvetres-2020-0021
Parole chiave
© 2020 F. Grippi et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Nucleotide sequences of primers and hydrolysis probe to amplification of lipL32 gene
Oligonucleotide | Sequence 5′–3′ |
---|---|
Primer F | GGTCTTTACACAATTTCTTTCACT |
Primer R | TGGGAAAAGCAGACCAACAGA |
Probe | AAGTGAAAGGATCTTTCGTTGTTGC |
Positive serum samples of cows on farm B by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 75)_ * <100 negative samples_ ** New positive samples found at T1
Positive samples | Antibody titre |
|||
---|---|---|---|---|
(n = 75) | T0 | T1 | T2 | T3 |
1 | 1,600 | 800 | 800 | <100 |
2 | 100 | 100 | <100* | <100 |
3 | 1,600 | 3,200 | 1,600 | <100 |
4 | 800 | 800 | 400 | <100 |
5 | 100 | 100 | <100* | <100 |
6 | 400 | 800 | 800 | <100 |
7 | 100 | 200 | <100* | <100 |
8 | 100 | 100 | <100* | <100 |
9 | 200 | 200 | <100* | <100 |
10 | 100 | 100 | <100* | <100 |
11 | 800 | 400 | 400 | <100 |
12 | 800 | 800 | <100* | <100 |
13 | 1,600 | 800 | 400 | <100 |
14 | 400 | 800 | 400 | <100 |
15 | 100 | 100 | <100* | <100 |
16 | 800 | 800 | 800 | <100 |
17 | 800 | 1,600 | 1,600 | <100 |
18 | 400 | 200 | <100* | <100 |
19 | 1,600 | 1,600 | 800 | <100 |
20 | 200 | 200 | 200 | <100 |
21 | 100 | 200 | <100* | <100 |
22 | 200 | 200 | 200 | <100 |
23 | 800 | 400 | 200 | <100 |
24 | 1,600 | 1,600 | 1,600 | <100 |
25 | 3,200 | 3,200 | 1,600 | <100 |
26 | 800 | 800 | 400 | <100 |
27 | 800 | 800 | 800 | <100 |
28 | 200 | 200 | 200 | <100 |
29 | 800 | 800 | 400 | <100 |
30 | <100* | 100** | <100* | <100 |
31 | <100* | 200** | 200 | <100 |
Serum samples of cows on the farm A by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 23)_ * <100 negative samples
Positive samples (n = 23) | Antibody titre T0 | Antibody titre T1 | Antibody titre T2 |
---|---|---|---|
1 | 400 | 200 | <100* |
2 | 400 | <100* | <100* |