Leptospira interrogans serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)

Fig. 1

Nucleotide sequences of primers and hydrolysis probe to amplification of lipL32 gene

Oligonucleotide	Sequence 5′–3′
Primer F	GGTCTTTACACAATTTCTTTCACT
Primer R	TGGGAAAAGCAGACCAACAGA
Probe	AAGTGAAAGGATCTTTCGTTGTTGC

Positive serum samples of cows on farm B by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 75)_ * <100 negative samples_ ** New positive samples found at T1

Positive samples	Antibody titre
(n = 75)	T0	T1	T2	T3
1	1,600	800	800	<100
2	100	100	<100*	<100
3	1,600	3,200	1,600	<100
4	800	800	400	<100
5	100	100	<100*	<100
6	400	800	800	<100
7	100	200	<100*	<100
8	100	100	<100*	<100
9	200	200	<100*	<100
10	100	100	<100*	<100
11	800	400	400	<100
12	800	800	<100*	<100
13	1,600	800	400	<100
14	400	800	400	<100
15	100	100	<100*	<100
16	800	800	800	<100
17	800	1,600	1,600	<100
18	400	200	<100*	<100
19	1,600	1,600	800	<100
20	200	200	200	<100
21	100	200	<100*	<100
22	200	200	200	<100
23	800	400	200	<100
24	1,600	1,600	1,600	<100
25	3,200	3,200	1,600	<100
26	800	800	400	<100
27	800	800	800	<100
28	200	200	200	<100
29	800	800	400	<100
30	<100*	100**	<100*	<100
31	<100*	200**	200	<100

Serum samples of cows on the farm A by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 23)_ * <100 negative samples

Positive samples (n = 23)	Antibody titre T0	Antibody titre T1	Antibody titre T2
1	400	200	<100*
2	400	<100*	<100*