Open Access

Leptospira interrogans serogroup Sejroe serovar Hardjo in aborting cows: two herd cases in Sicily (Italy)

, , , , , ,  and   
Mar 24, 2020

Cite
Download Cover

Fig. 1

Geographical area where the farms are located
Geographical area where the farms are located

Nucleotide sequences of primers and hydrolysis probe to amplification of lipL32 gene

Oligonucleotide Sequence 5′–3′
Primer F GGTCTTTACACAATTTCTTTCACT

Primer R TGGGAAAAGCAGACCAACAGA

Probe AAGTGAAAGGATCTTTCGTTGTTGC

Positive serum samples of cows on farm B by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 75)_ * <100 negative samples_ ** New positive samples found at T1

Positive samples Antibody titre
(n = 75) T0 T1 T2 T3
1 1,600 800 800 <100

2 100 100 <100* <100

3 1,600 3,200 1,600 <100

4 800 800 400 <100

5 100 100 <100* <100

6 400 800 800 <100

7 100 200 <100* <100

8 100 100 <100* <100

9 200 200 <100* <100

10 100 100 <100* <100

11 800 400 400 <100

12 800 800 <100* <100

13 1,600 800 400 <100

14 400 800 400 <100

15 100 100 <100* <100

16 800 800 800 <100

17 800 1,600 1,600 <100

18 400 200 <100* <100

19 1,600 1,600 800 <100

20 200 200 200 <100

21 100 200 <100* <100

22 200 200 200 <100

23 800 400 200 <100

24 1,600 1,600 1,600 <100

25 3,200 3,200 1,600 <100

26 800 800 400 <100

27 800 800 800 <100

28 200 200 200 <100

29 800 800 400 <100

30 <100* 100** <100* <100

31 <100* 200** 200 <100

Serum samples of cows on the farm A by microscopic agglutination test (MAT) with cut-off of ≥100 (n = 23)_ * <100 negative samples

Positive samples (n = 23) Antibody titre T0 Antibody titre T1 Antibody titre T2
1 400 200 <100*

2 400 <100* <100*
Language:
English