<abstract xmlns="http://www.w3.org/1999/xhtml">

<p>Pollen nutrition is critical for the development and well-being of the honeybee. Previous studies have compared the effect of pollen and carbohydrate-only diet on honeybee physiology. The effect of a monofloral versus polyfloral diet on the African honeybee (<italic>Apis mellifera scutellata</italic>) is poorly understood. This knowledge is critical as diversity-rich habitats are being altered to less diverse environments through increased urbanization and intensified agricultural activities, particularly in sub-Saharan Africa. Here, we report how lowly diverse (LD) and highly diverse (HD) pollen diets influence honeybee life-history traits and physiology. To achieve this, we fed caged bees with the two pollen diets and tested their effects on the parameters of survival, body weight, pollen consumption, and immune response. HD-fed bees had significantly higher survival and greater pollen consumption than LD-fed bees. However, LD-fed bees were heavier than HD-fed bees. The correlation between body weight gain and pollen consumption was expressed strongly in HD-fed bees than in LD-fed bees. Overall, our findings reveal the benefits that the highly diverse polyfloral diets provide to honeybee workers. This study shows how pollen diversity influences honeybee life-history traits, thus informing the need for conserving the biodiversity of environments for safeguarding the health of honeybees and other pollinators.</p>
</abstract>

Pollen nutrition is critical for the development and well-being of the honeybee. Previous studies have compared the effect of pollen and carbohydrate-only diet on honeybee physiology. The effect of a monofloral versus polyfloral diet on the African honeybee (Apis mellifera scutellata) is poorly understood. This knowledge is critical as diversity-rich habitats are being altered to less diverse environments through increased urbanization and intensified agricultural activities, particularly in sub-Saharan Africa. Here, we report how lowly diverse (LD) and highly diverse (HD) pollen diets influence honeybee life-history traits and physiology. To achieve this, we fed caged bees with the two pollen diets and tested their effects on the parameters of survival, body weight, pollen consumption, and immune response. HD-fed bees had significantly higher survival and greater pollen consumption than LD-fed bees. However, LD-fed bees were heavier than HD-fed bees. The correlation between body weight gain and pollen consumption was expressed strongly in HD-fed bees than in LD-fed bees. Overall, our findings reveal the benefits that the highly diverse polyfloral diets provide to honeybee workers. This study shows how pollen diversity influences honeybee life-history traits, thus informing the need for conserving the biodiversity of environments for safeguarding the health of honeybees and other pollinators.

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

Environmental Health Theme, International Centre of Insect Physiology and Ecology (icipe)

Jomo Kenyatta University of Agriculture and Technology

Journal of Apicultural Science

This work is licensed under the Creative Commons Attribution 4.0 International License.

Pollen nutrition is critical for the development and well-being of the honeybee. Previous studies have compared the effect of pollen and carbohydrate-only diet...

Gene ID	Primer	Amplicon size (bp)	Annealing temperature (°C)	Primer reference
Tata Binding Protein (TBP)	F: TTGGTTTCATTAGCTGCACAAR: ACTGCGGGAGTCAAATCTTC	149	53.5	Tesovnik et al., 2017
defensin-2	F: GCAACTACCGCCTTTACGTCR: GGGTAACGTGCGACGTTTTA	159	55.0	Tesovnik et al., 2017

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

Article Category: Original Article

Data publikacji: 22 cze 2022

Zakres stron: 29 - 43

Otrzymano: 25 maj 2021

Przyjęty: 20 sty 2022

DOI: https://doi.org/10.2478/jas-2022-0003

Słowa kluczowe
defensin, innate immunity, nutrition, pollen consumption, weight gain

© 2022 Michael N. K. Muturi et al., published by Sciendo

This work is licensed under the Creative Commons Attribution 4.0 International License.

Fig. 1

Fig. 2

Fig. S1

Fig. S2

Characteristics of the pollen used to create different pollen diets. The high diversity (HD) pollen diet was created by mixing all 10 pollen types at equal frequency while the low diversity (LD) pollen diet consisted exclusively of pollen type 1.

List of primers for TBP and Defensin-2.

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

Article Category: Original Article

Data publikacji: 22 cze 2022

Zakres stron: 29 - 43

Otrzymano: 25 maj 2021

Przyjęty: 20 sty 2022

DOI: https://doi.org/10.2478/jas-2022-0003

Słowa kluczowedefensin, innate immunity, nutrition, pollen consumption, weight gain

© 2022 Michael N. K. Muturi et al., published by Sciendo

This work is licensed under the Creative Commons Attribution 4.0 International License.

Fig. 1

Fig. 2

Fig. S1

Fig. S2

Characteristics of the pollen used to create different pollen diets. The high diversity (HD) pollen diet was created by mixing all 10 pollen types at equal frequency while the low diversity (LD) pollen diet consisted exclusively of pollen type 1.

List of primers for TBP and Defensin-2.

Słowa kluczowe
defensin, innate immunity, nutrition, pollen consumption, weight gain