Accesso libero

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

,  e   
22 giu 2022
INFORMAZIONI SU QUESTO ARTICOLO

Cita
Scarica la copertina

Fig. 1

Survival analysis for different feeding regimens.Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.
Survival analysis for different feeding regimens.Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.

Fig. 2

Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).
Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).

Fig. S1

Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.
Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.

Fig. S2

Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.
Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.

Characteristics of the pollen used to create different pollen diets_ The high diversity (HD) pollen diet was created by mixing all 10 pollen types at equal frequency while the low diversity (LD) pollen diet consisted exclusively of pollen type 1_

List of primers for TBP and Defensin-2_

Gene ID Primer Amplicon size (bp) Annealing temperature (°C) Primer reference
Tata Binding Protein (TBP) F: TTGGTTTCATTAGCTGCACAAR: ACTGCGGGAGTCAAATCTTC 149 53.5 Tesovnik et al., 2017
defensin-2 F: GCAACTACCGCCTTTACGTCR: GGGTAACGTGCGACGTTTTA 159 55.0 Tesovnik et al., 2017
Lingua:
Inglese
Frequenza di pubblicazione:
2 volte all'anno
Argomenti della rivista:
Scienze biologiche, Zoologia, Scienze della vita, altro