Acceso abierto

Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee

Michael N. K. Muturi

Michael N. K. Muturi

  • Environmental Health Theme, International Centre of Insect Physiology and Ecology (icipe)Kenya
  • Department of Biochemistry, Jomo Kenyatta University of Agriculture and TechnologyKenya
Buscar este autor en
Sciendo|Google Scholar
Muturi, Michael N. K.
, 
Joel L. Bargul

Joel L. Bargul

  • Environmental Health Theme, International Centre of Insect Physiology and Ecology (icipe)Kenya
  • Department of Biochemistry, Jomo Kenyatta University of Agriculture and TechnologyKenya
Buscar este autor en
Sciendo|Google Scholar
Bargul, Joel L.
 y 
H. Michael G. Lattorff

H. Michael G. Lattorff

  • Environmental Health Theme, International Centre of Insect Physiology and Ecology (icipe)Kenya
  • Department of Chemistry, University of NairobiKenya
Buscar este autor en
Sciendo|Google Scholar
Lattorff, H. Michael G.
  
22 jun 2022
Influence of the Type of Pollen Diet on the Survival, Body Weight, and Immune Response in the African Honeybee's Cover Image
Acerca de este artículo
Artículo anterior
Artículo siguiente
Cite
Descargar portada
Categoría del artículo: Original Article
Publicado en línea: 22 jun 2022
Páginas: 29 - 43
Recibido: 25 may 2021
Aceptado: 20 ene 2022
DOI: https://doi.org/10.2478/jas-2022-0003
Palabras clave
© 2022 Michael N. K. Muturi et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Fig. 1

Survival analysis for different feeding regimens.Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.
Survival analysis for different feeding regimens.Black dashed line - highly diverse (HD) pollen diet, blue dotted line - lowly diverse (LD) pollen diet.

Fig. 2

Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).
Correlation of daily pollen consumption and daily weight change for (a) highly diverse (HD) pollen diet and (b) lowly diverse (LD) pollen diet).

Fig. S1

Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.
Protein content of different pollen diets. HD – highly diverse pollen diet, LD – lowly diverse pollen diet.

Fig. S2

Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.
Interaction plot for a) pollen consumption and b) daily bee body weight from day 1–5.Blue line - highly diverse (HD) pollen diet, orange line - lowly diverse (LD) pollen diet.

Characteristics of the pollen used to create different pollen diets_ The high diversity (HD) pollen diet was created by mixing all 10 pollen types at equal frequency while the low diversity (LD) pollen diet consisted exclusively of pollen type 1_

List of primers for TBP and Defensin-2_

Gene ID Primer Amplicon size (bp) Annealing temperature (°C) Primer reference
Tata Binding Protein (TBP) F: TTGGTTTCATTAGCTGCACAAR: ACTGCGGGAGTCAAATCTTC 149 53.5 Tesovnik et al., 2017
defensin-2 F: GCAACTACCGCCTTTACGTCR: GGGTAACGTGCGACGTTTTA 159 55.0 Tesovnik et al., 2017
Idioma:
Inglés
Calendario de la edición:
2 veces al año
Temas de la revista:
Ciencias de la vida, Zoología, Ciencias de la vida, otros
RSS Feed de revista