1. bookTom 76 (2022): Zeszyt 1 (January 2022)
Informacje o czasopiśmie
License
Format
Czasopismo
eISSN
1732-2693
Pierwsze wydanie
20 Dec 2021
Częstotliwość wydawania
1 raz w roku
Języki
Angielski
Otwarty dostęp

Salivary HPV infection in healthy people

Data publikacji: 29 May 2022
Tom & Zeszyt: Tom 76 (2022) - Zeszyt 1 (January 2022)
Zakres stron: 143 - 148
Otrzymano: 30 Dec 2020
Przyjęty: 11 Aug 2021
Informacje o czasopiśmie
License
Format
Czasopismo
eISSN
1732-2693
Pierwsze wydanie
20 Dec 2021
Częstotliwość wydawania
1 raz w roku
Języki
Angielski
Abstract Introduction

In recent years, interest in human papillomavirus infections as a causative factor in epithelial cancer development has grown. Literature indicates that HPV involvement in malignant transformations in oral mucosa can vary significantly, from 0 up to 87%. The aim of our study was to detect the prevalence of salivary HPV infection among generally healthy adults.

Materials and Methods

The examination involved 139 patients, from whom 139 whole, 1.5ml saliva samples were obtained. HPV DNA was detected by the nested PCR technique. To visualize the PCR products electrophoresis reactions were carried out.

Results

Sample analysis showed that DNA for HPV was detected in 14 patients: 11 positive results were obtained from men, and 3 from women. This yields a high infection rate: 10.07%.

Conclusions

The HPV prevalence in the male group was more than twice as high as in the female group. Also, subclinical oral HPV infection was detected more frequently in young (19–39 years old) and older (=>60 years old) adults.

Keywords

Introduction

In recent years interest has grown in human papillomavirus infections as a causative factor in epithelial cancer development [1, 2, 3, 4, 5]. Human papillomavirus is part of a larger DNA virus family, the Papillomaviridae. They are built up from double-stranded DNA. So far more than 100 HPV genotypes have been described. They are divided into two groups: high and low oncogenic risk. Among low-risk HPVs we can distinguish, e.g., HPV6, HPV11, HPV1, HPV2. High-risk HPVs such as HPV16, HPV18, HPV31, HPV33, HPV45 are described as having high potential for malignant progression [4]. Almost 45 genotypes of HPV have been detected in cervical cancer [1]. The high oncogenic potential of some HPV genotypes is believed to be connected with two specific oncoproteins: oncoproteins E6 and E7, which are crucial for promoting viral transformation in epithelial tissue. Those two oncoproteins alter the function of genes p53 and pRb, which are responsible for tumor suppression. Both of those oncoproteins trigger proliferation and cell immortalization and induce genomic instability [4].

HPV occurrence is ubiquitous. The transmission of the virus is via direct contact. Sound skin or mucosa is resistant to its inoculation. Healthy individuals can be reservoirs for HPV. The incidence of HPV in not pathologically changed oral epithelium can vary from 0.6% up to 81%. This discrepancy is due to the DNA detection methods used, and the means of specimen acquisition. The oral cavity can be infected with HPV by autoinfection, during labor from an infected mother to a child, or by oral sex [6, 7, 8]. No evidence exists that HPV is an airborne virus.

Numerous publications indicate the association of HPV in the presence and development of oral mucosal lesions, such as oral squamous cell papilloma, condyloma accuminatum, Heck's disease, oral leukoplakia, verrucous leukoplakia, oral lichen planus (OLP), and oral squamous cell carcinoma (SCC) [1, 2, 3, 4, 5, 9, 10, 11, 12, 13].

Human papilloma virus as a cervical cancer factor has been widely proven, both biologically and epidemiologically [4]. But nowadays there is also greater interest in HPV as a causal agent in other epithelial regions, such as oral cavity diseases. Literature indicates that HPV involvement in malignant transformations in oral mucosa can range from 0 up to 87%. HPV16 considered as a high-risk genotype is the most prevalent HPV type in cervical squamous cell carcinoma; it is also the most detected HPV type in all head and neck SCC [1, 3, 5, 6, 7, 8].

The aim of our study was to detect the prevalence of salivary HPV infection among generally healthy adults.

Materials and Methods
Patients

The examination was performed on 139 patients in good general condition: university students, hospital staff, and members of the general public, without oral mucosal lesions. The oral cavity state was checked in a clinical examination. Subsequently after about fifteen minutes of rest, unstimulated saliva samples were collected into an Eppendorf tube by a dentist. All research participants gave written consent to take part in the study. The study was approved by the Wrocław Medical University Bioethics Committee (No. B-661/2018).

To provide full anonymity each of the patients was given an individual identification number.

DNA extraction

Saliva was collected by spitting into a sterile 1.5 ml Eppendorf tube; samples were stored at −24°C until testing. Before molecular biology analysis, obtained saliva samples were thawed on ice. DNA isolation was performed, using a modified CTAB (cetyltrimethylammonium bromide) method, the prototype of which is included in the publication of Song et al. [14]. The changes made during the study were made to adapt to the laboratory's conditions and available equipment. As an internal control of the DNA extraction, samples with DNA were subjected to endpoint PCR for human β-globin gene amplification, by using GH20 5′ (GAAGAGCCAAGGACAGGTAC)3′ and PCO4 (5′TCACCACAACTTCATCCACGTTCACC3′) oligonucleotides, which flank a sequence of about 268 pb. Samples that were positive for human β-globin gene were subjected to viral DNA search for HPV. After reanalyzing samples for confirmation only negative samples for β-globin gene were excluded from the analysis.

HPV DNA amplification

In our study HPVs were detected by nested PCR. This PCR required two different, conventional pairs of oligonucleotide primers to detect HPV: MY09/MY11, GP5+/GP6+, one by one. The PCR reaction mixture was prepared according to well-defined proportions of reagents. A sample calculated per one reaction was: 25 μL DreamTaq Green PCR MasterMix (Thermo Scientific), 18.75 μL Water nuclease free (Thermo Scientific), 1.25 μL of primers at a concentration of 20 pml/μL and 5 μL suspension of isolated DNA from saliva. For each series of samples subjected to nested PCRca, a positive control sample and also a negative control sample (H2O) were carried out. Positive control material contained purified genomic HPV type 16 DNA suspension: Amplirun Papillomavirus DNA Control Sample (Vircell Microbiologists) at concentration 1000 copies/of genomic HPV DNA. The temperature and conditions of nested PCR were adjusted to the recommendations of the manufacturer's Dream Taq Green PCR Master Mix and the melting temperatures of the primers (Table 1). The amplified genetic material was subjected to electrophoresis for several hours from the time of isolation, and until then kept in a refrigerator at 4°C.

Conditioning protocol of nested PCR technique using primer pairs: MY09/11 and GP5+/6+

Set primers Reaction step Temperature, °C Duration Number of repetitions
MY09/11 Initial denaturation 95 3 min -
Denaturation 95 30 s 40×
Hybridization of primers 53 30 s
Amplification DNA 72 45 s
Final amplification 72 5 min -
- 4 -
GP5+/GP6+ Initial denaturation 94 5 min -
Denaturation 94 1 min 30×
Hybridization of primers 48 2 min
Amplification DNA 72 1 min
Final amplification 72 5 min -
- 4 -
Electrophoresis reaction

To visualize the PCR products, an electrophoresis reaction was carried out in a 2% agarose gel in the 1 × concentrated TAE mixture (242g Tris pH 8.3; 100ml 0.5 M EDTA pH 8; 57.2ml CH3COOH per 1000 ml) in the presence of MIDORI Green Advance DNA Stain (NIPPON Genetics EUROPE GmbH). For the number of base pairs a standard DNA GeneRuler 100 bp DNA Ladder (Fermentas, Thermo) was used. Visualization of electrophoresis results was performed under UV light with the use of Gel DOC EZ Imager, BioRad.

Results

The research material consisted of 139 saliva samples, from 139 patients: 57 women and 82 men, aged between 19 and 74 years. Sample analysis showed that DNA-HPV was detected in 14 patients: 11 positive results were obtained from men, and 3 from women. Mean patient age was 32. The study revealed that the most commonly HPV DNA was detected in subjects between 19 and 39 years old. Genetic material of the virus was detected in 12 samples from subjects in this age range (Table 2).

Total sample description and detection of DNA-HPV in relation with gender and age groups

Patientsn=139 Positive HPV resultn=14
Male 82 11
Female 57 3
19–39 years old 106 12
40–59 years old 9 0
60+ years old 24 2
Discussion

Numerous studies have assessed the prevalence of human papillomavirus in the oral cavity. HPV was detected in various oral specimens collected from saliva, oral rinse samples, gargle with mouthwash samples, epithelial cells after exfoliation, from different pathological oral lesions, and even from healthy, asymptomatic oral mucosa. In these studies the occurrence of the oral HPV infection was sometimes completely different, ranging from 1.9% up to 10% [15]. This could be explained by the use of other DNA extraction methods, different populations with low or high risk for the infection, populations from different geographical regions, and of course because of different sample collections [12, 14, 16, 17, 18].

Saliva samples have many advantages: they can be provided easily, without invasive procedures, in a short time and are safe for the patients. Their collection takes only few minutes, and the obtained sample has the right volume for further testing.

In our study collection of 1.5ml of whole saliva took about 7 minutes in patients with proper salivary flow. In order to check the frequency of asymptomatic HPV infections, 139 healthy people were qualified for the study – e.g., without immunodeficiency, not organ recipients, not during immunosuppressive therapy. This is due to the fact that the frequency of infections, including HPV, among people with a disturbed immune system could be significantly higher than in healthy people of the same age. The average patient's age was 32 years. We estimated general HPV infection for all HPV types.

14 samples out of 139 revealed positive results for HPV: this is a high infection rate, at the level of 10.07%. A bit lower levels of HPV infection were presented by other research for all types of HPV in healthy individuals: 7.7% in the meta-analysis of 66 studies done by Tam et al. [19], 7.5% in the work of Wood et al. [20] in which 3762 individuals were included. However, a lower frequency (6.9%) was demonstrated in the work of Gillison et al. [8] with 5579 participants, and prevalence of 5.5% in the meta-analysis of Shigeishi and Sugiyama [21] of 29 studies with 22,756 individuals. A case-control study conducted in England by Hearden et al. [22] in a mixed population of 700 participants, incorporating university students, hospital staff, dental patients, and the general public, the prevalence of oral HPV was 5.5%, while in a meta-analysis of 48 reports comprising 28,544 subjects Mena et al. [23] reported even lower infection frequency, at 4.9%.

In our research group there were 59% males and 41% females. It is worth underlining that HPV prevalence in the male group was more twice as high (13.41%) as in the female group (5.26%).

Similar observations have been presented in other studies. Sonawage et al. [8], on the basis of a large representative population of 11 million men and 3.2 million women, found that the prevalence of HPV infection was three times more frequent in males than in females: 11.5% and 3.2% accordingly. Similarly on the basis of a USA cross-sectional study of a large number of participants (5579), Gillison et al. [17] revealed 3 times higher HPV infection prevalence in men (10.1%) when compared in women (3.6%).

When the age of participants was taken into account, the observation was also very interesting. The group of people between 19 to 39 years old constituted 76.26% of all of the participants; HPV infection was detected in 11.32% of them, the highest rate.

The increase in HPV infections in the age group 19–39 could be related to the increased sexual activity of individual people in this group. It is well known that HPV infections are transmitted mainly through sexual contact, which is not limited to genitalgenital relations, because they can also be genital-manual, genital-oral, or genital-anal.

None of the subjects in the middle-aged group (40–59 years old), 6.67% of the entire group of patients, had the HPV infection. In turn, senior patients (≥60 years old), 17.26% of all of the study subjects, revealed HPV infection at the level of 8.33%.

Similar findings were also demonstrated by other authors, where the HPV infection prevalence peak was observed among young people aged 30 to 34 years old (7.3% infected), and elders 60–64 years old (11.4%) [17].

On the one hand, our findings and those of others prove the frequent presence of HPV infections in the oral cavity, which can be mostly asymptomatic. On the other hand, mucosal lesions related to HPV infections are observed as focal epithelial hyperplasia, oral papillomas, oral warts [11, 15]. These pathological lesions are not common and have no carcinogenic potential, as they are related to low-risk HPV types such as HPV6, 11, 13, 32. In the context of the potential role of HPV as promoter of the malignant transformation of precancerous oral disorders this hypothesis is still equivocal.

The occurrence of HPV infection in oral mucosal lesions is also not clear. De Abreu et al. [24] investigated the status of HPV in a cohort of 90 biopsied oral squamous cell carcinomas (OSCC) of Brazilian patients. Study showed a low 3.3% frequency of HPV infection and detection of HPV16 in all of the cases, which is the most common type. Additionally, his study revealed that in pre-malignant non-homogeneous leukoplakias HPV was found less frequently than in homogenous types, which are considered to have better prognosis due to lower levels of malignancy. However, oral leukoplakia shows an increased risk of HPV infection when compared to clinically healthy mucosa, with its prevalence of around 20% [9].

Other meta-analyses also indicated no clear association between HPV infection and oral squamous cell carcinoma, but proved this association with oropharyngeal SCC [2, 9]. The latest published study pointed out a relation between tumor p-16 expression and oral HPV16 infection in oropharyngeal cancer [25].

Finally it must be emphasized that there are many risk factors contributing to oral malignancy development. HPV infection may not be the most important one, but may be overlapping or inducing the other local and general factors. It is well known that HPV is the most common sexually transmitted infection. Its transmission to the oral cavity, and the enhancement of the risk of premalignancy and development of oral cancer, is increased in women with cervical infection that confirms the possible transmission between oral cavity and genitals.

Oral HPV infection is significantly higher, more than 10%, in women with cervical infection than in the general population of healthy women without cervical infection. The study of Cossellu [6] reports the presence of oral infection in 20.4% of women with gynecological infection.

This study has limitations, because there are no additional parameters that could be taken into consideration when the assessment of the risk factors for HPV infection is conducted.

On the other hand, we focused on saliva as a very convenient sample to detect viral infection. Current outcomes of Tang et al.'s [25] research clearly support the knowledge that HPV detection in saliva can be a biomarker to confirm this infection in the oral cavity in every suspected case.

Conclusions

In our research the prevalence of HPV infection detected in whole saliva was a little higher than in studies conducted by cited authors. This study showed that subclinical oral HPV infection is present more often in men than in women. It was also more frequently seen in the young and in elder people. Our results propose that dental practitioners should have the knowledge of HPV risks and involve themselves in the early detection of all the oral mucosal lesions associated with HPV infection.

Total sample description and detection of DNA-HPV in relation with gender and age groups

Patientsn=139 Positive HPV resultn=14
Male 82 11
Female 57 3
19–39 years old 106 12
40–59 years old 9 0
60+ years old 24 2

Conditioning protocol of nested PCR technique using primer pairs: MY09/11 and GP5+/6+

Set primers Reaction step Temperature, °C Duration Number of repetitions
MY09/11 Initial denaturation 95 3 min -
Denaturation 95 30 s 40×
Hybridization of primers 53 30 s
Amplification DNA 72 45 s
Final amplification 72 5 min -
- 4 -
GP5+/GP6+ Initial denaturation 94 5 min -
Denaturation 94 1 min 30×
Hybridization of primers 48 2 min
Amplification DNA 72 1 min
Final amplification 72 5 min -
- 4 -

Bouda M, Gorgoulis VG, Kastrinakis NG, Giannoudis A, Tsoli E, Danassi-Afentaki D, Foukas P, Kyroudi A, Laskaris G, Herrington CS, Kittas C. “High risk” HPV types are frequently detected in potentially malignant and malignant oral lesions, but not in normal oral mucosa. Modern Pathology. 2000; 13: 644–653. BoudaM GorgoulisVG KastrinakisNG GiannoudisA TsoliE Danassi-AfentakiD FoukasP KyroudiA LaskarisG HerringtonCS KittasC “High risk” HPV types are frequently detected in potentially malignant and malignant oral lesions, but not in normal oral mucosa Modern Pathology 2000 13 644 653 10.1038/modpathol.388011310874669 Search in Google Scholar

Kreimer AR, Clifford GM, Boyle P, Franceschi S. Human papillomavirus types in head and neck squamous cell carcinomas worldwide: A systematic review. Cancer Epidemiol Prevention Biomarkers Prev. 2005; 14: 467–475. KreimerAR CliffordGM BoyleP FranceschiS Human papillomavirus types in head and neck squamous cell carcinomas worldwide: A systematic review Cancer Epidemiol Prevention Biomarkers Prev 2005 14 467 475 10.1158/1055-9965.EPI-04-055115734974 Search in Google Scholar

Miller CS, Johnstone BM. Human papillomavirus as a risk factor for oral squamous cell carcinoma: A meta-analysis, 1982–1997. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2001; 91: 622–635. MillerCS JohnstoneBM Human papillomavirus as a risk factor for oral squamous cell carcinoma: A meta-analysis, 1982–1997 Oral Surg Oral Med Oral Pathol Oral Radiol Endod 2001 91 622 635 10.1067/moe.2001.11539211402272 Search in Google Scholar

Prabhu SR, Wilson DF. Human papillomavirus and oral disease – emerging evidence: A review. Aust Dent J. 2013; 58: 2–10. PrabhuSR WilsonDF Human papillomavirus and oral disease – emerging evidence: A review Aust Dent J 2013 58 2 10 10.1111/adj.1202023441786 Search in Google Scholar

Wagner S, Sharma SJ, Wuerdemann N, Knuth J, Reder H, Wittekindt C, Klussmann JP. Human papillomavirus-related head and neck cancer. Oncol Res Treat. 2017; 40: 334–340. WagnerS SharmaSJ WuerdemannN KnuthJ RederH WittekindtC KlussmannJP Human papillomavirus-related head and neck cancer Oncol Res Treat 2017 40 334 340 10.1159/00047725228521311 Search in Google Scholar

Cossellu G, Fedele L, Badaoui B, Angiero F, Farronato G, Monti E, Liverani CA, Gorni C, Botti S. Prevalence and concordance of oral and genital HPV in women positive for cervical HPV infection and in their sexual stable partners: An Italian screening study. PLoS One, 2018; 13: e0205574. CosselluG FedeleL BadaouiB AngieroF FarronatoG MontiE LiveraniCA GorniC BottiS Prevalence and concordance of oral and genital HPV in women positive for cervical HPV infection and in their sexual stable partners: An Italian screening study PLoS One 2018 13 e0205574 10.1371/journal.pone.0205574619364630335788 Search in Google Scholar

D’Souza G, Agrawal Y, Halpern J, Bodison S, Gillison ML. Oral sexual behaviors associated with prevalent oral human papillomavirus infection. J Infect Dis. 2009; 199: 1263–1269. D’SouzaG AgrawalY HalpernJ BodisonS GillisonML Oral sexual behaviors associated with prevalent oral human papillomavirus infection J Infect Dis 2009 199 1263 1269 10.1086/597755470308619320589 Search in Google Scholar

Sonawane K, Suk R, Chiao EY, Chhatwal J, Qiu P, Wilkin T, Nyitray AG, Sikora AG, Deshmukh AA. Oral human papillomavirus infection: Differences in prevalence between sexes and concordance with genital human papillomavirus infection, NHANES 2011 to 2014. Ann Intern Med. 2017; 167: 714–724. SonawaneK SukR ChiaoEY ChhatwalJ QiuP WilkinT NyitrayAG SikoraAG DeshmukhAA Oral human papillomavirus infection: Differences in prevalence between sexes and concordance with genital human papillomavirus infection, NHANES 2011 to 2014 Ann Intern Med 2017 167 714 724 10.7326/M17-1363620369229049523 Search in Google Scholar

Candotto V, Lauritano D, Nardone M, Baggi L, Arcuri C, Gatto R, Gaudio RM, Spadari F, Carinci F. HPV infection in the oral cavity: Epidemiology, clinical manifestations and relationship with oral cancer. Oral Implantol. 2017; 10: 209–220. CandottoV LauritanoD NardoneM BaggiL ArcuriC GattoR GaudioRM SpadariF CarinciF HPV infection in the oral cavity: Epidemiology, clinical manifestations and relationship with oral cancer Oral Implantol 2017 10 209 220 10.11138/orl/2017.10.3.209573538429285322 Search in Google Scholar

Feller L, Lemmer J. Oral leukoplakias as it relates to HPV infection: A review. Int J Dent. 2012; 2012: 540561. FellerL LemmerJ Oral leukoplakias as it relates to HPV infection: A review Int J Dent 2012 2012 540561 10.1155/2012/540561329925322505902 Search in Google Scholar

Radzki D, Baiduk K, Burzyńska M, Lisai A, Machut K, Pańszczyk A, Bochniak M, Kusiak A. Rola brodawczaka ludzkiego w patologii jamy ustnej - przegląd piśmiennictwa. Dent Forum. 2018; 46: 67–74. RadzkiD BaidukK BurzyńskaM LisaiA MachutK PańszczykA BochniakM KusiakA Rola brodawczaka ludzkiego w patologii jamy ustnej - przegląd piśmiennictwa Dent Forum 2018 46 67 74 10.20883/df.2018.9 Search in Google Scholar

Ribeiro MG, Marcolino LD, Ramos BR, Miranda EA, Trento CL, Jain S, Gurgel RQ, da Silva MG, Dolabella SS. High prevalence of human papillomavirus (HPV) in oral mucosal lesions of patients at the Ambulatory of Oral Diagnosis of the Federal University of Sergipe, Northeastern Brazil. J Appl Oral Sci. 2017; 25: 69–74. RibeiroMG MarcolinoLD RamosBR MirandaEA TrentoCL JainS GurgelRQ da SilvaMG DolabellaSS High prevalence of human papillomavirus (HPV) in oral mucosal lesions of patients at the Ambulatory of Oral Diagnosis of the Federal University of Sergipe, Northeastern Brazil J Appl Oral Sci 2017 25 69 74 10.1590/1678-77572016-0313528940228198978 Search in Google Scholar

Yildirim B, Sengüven B, Demir C. Prevalence of herpes simplex, Epstein Barr and human papilloma viruses in oral lichen planus. Med Oral Patol Oral Cir Bucal. 2011; 16: e170–e174. YildirimB SengüvenB DemirC Prevalence of herpes simplex, Epstein Barr and human papilloma viruses in oral lichen planus Med Oral Patol Oral Cir Bucal 2011 16 e170 e174 10.4317/medoral.16.e17021196875 Search in Google Scholar

Mravak-Stipetic M, Sabol I, Kranjčić J, Knežević M, Grce M. Human papillomavirus in the lesions of the oral mucosa according to topography. PLoS One. 2013; 8: e69736. Mravak-StipeticM SabolI KranjčićJ KneževićM GrceM Human papillomavirus in the lesions of the oral mucosa according to topography PLoS One 2013 8 e69736 10.1371/journal.pone.0069736372676823922786 Search in Google Scholar

Chattopadhyay A, Weatherspoon D, Pinto A. Public health implications of human papillomavirus oral infection: A brief overview. Curr Oral Health Rep. 2014; 1: 143–147. ChattopadhyayA WeatherspoonD PintoA Public health implications of human papillomavirus oral infection: A brief overview Curr Oral Health Rep 2014 1 143 147 10.1007/s40496-014-0026-7 Search in Google Scholar

D’Souza G, McNeel TS, Fakhry C. Understanding personal risk of oropharyngeal cancer: Risk groups for oncogenic oral HPV infection and oropharyngeal cancer. Ann Oncol. 2017; 28: 3065–3069. D’SouzaG McNeelTS FakhryC Understanding personal risk of oropharyngeal cancer: Risk groups for oncogenic oral HPV infection and oropharyngeal cancer Ann Oncol 2017 28 3065 3069 10.1093/annonc/mdx535583413629059337 Search in Google Scholar

Gillison ML, Broutian T, Pickard RK, Tong ZY, Xiao W, Kahle L, Graubard BI, Chaturvedi AK. Prevalence of oral HPV infection in the United States, 2009–2010. JAMA, 2012; 307: 693–703. GillisonML BroutianT PickardRK TongZY XiaoW KahleL GraubardBI ChaturvediAK Prevalence of oral HPV infection in the United States, 2009–2010 JAMA 2012 307 693 703 10.1001/jama.2012.101579018822282321 Search in Google Scholar

Visalli G, Currò M, Facciolà A, Riso R, Mondello P, Laganà P, Di Pedro A, Picerno I, Spataro P. Prevalence of human papillomavirus in saliva of women with HPV genital lesions. Infect Agents Cancer. 2016; 11: 48. VisalliG CurròM FacciolàA RisoR MondelloP LaganàP Di PedroA PicernoI SpataroP Prevalence of human papillomavirus in saliva of women with HPV genital lesions Infect Agents Cancer 2016 11 48 10.1186/s13027-016-0096-3500046427570540 Search in Google Scholar

Tam S, Fu S, Xu L, Krause KJ, Lairson DR, Miao H, Sturgis EM, Dahlstrom KR. The epidemiology of oral human papillomavirus infection in healthy populations: A systemic review and meta-analysis. Oral Oncol. 2018; 82: 91–99. TamS FuS XuL KrauseKJ LairsonDR MiaoH SturgisEM DahlstromKR The epidemiology of oral human papillomavirus infection in healthy populations: A systemic review and meta-analysis Oral Oncol 2018 82 91 99 10.1016/j.oraloncology.2018.04.00529909908 Search in Google Scholar

Wood ZC, Bain CJ, Smith DD, Whiteman DC, Antonsson A. Oral human papillomavirus infection incidence and clearance: A systemic review of the literature. J Gen Virol. 2017; 98: 519–526. WoodZC BainCJ SmithDD WhitemanDC AntonssonA Oral human papillomavirus infection incidence and clearance: A systemic review of the literature J Gen Virol 2017 98 519 526 10.1099/jgv.0.00072728150575 Search in Google Scholar

Shigeishi H, Sugiyama M. Risk factors for oral human papillomavirus infection in healthy individuals: A systemic review and meta-analysis. J Clin Med Res. 2016; 8: 721–729. ShigeishiH SugiyamaM Risk factors for oral human papillomavirus infection in healthy individuals: A systemic review and meta-analysis J Clin Med Res 2016 8 721 729 10.14740/jocmr2545w501224127635177 Search in Google Scholar

Hearnden V, Murdoch C, D’Apice K, Duthie S, Hayward NJ, Powers HJ. Oral human papillomavirus infection in England and associated risk factors: A case-control study. BMJ Open. 2018; 8: e022497. HearndenV MurdochC D’ApiceK DuthieS HaywardNJ PowersHJ Oral human papillomavirus infection in England and associated risk factors: A case-control study BMJ Open 2018 8 e022497 10.1136/bmjopen-2018-022497610475330122664 Search in Google Scholar

Mena M, Taberna M, Monfil L, Arbyn M, de Sanjosé S, Bosch FX, Alemany L, Bruni L. May oral human papillomavirus (HPV) infection in healthy individuals explain differences in HPV-attributable fractions in oropharyngeal cancer? A systemic review and meta-analysis. J Infect Dis. 2019; 219: 1574–1585. MenaM TabernaM MonfilL ArbynM de SanjoséS BoschFX AlemanyL BruniL May oral human papillomavirus (HPV) infection in healthy individuals explain differences in HPV-attributable fractions in oropharyngeal cancer? A systemic review and meta-analysis J Infect Dis 2019 219 1574 1585 10.1093/infdis/jiy715647317330590684 Search in Google Scholar

de Abreu PM, Có ACG, Azevedo PL, do Valle IB, de Oliveira KG, Gouvea SA, Cordeiro-Silva MF, Louro ID, de Podestá JRV, Lenzi J, et al. Frequency of HPV in oral cavity squamous cell carcinoma. BMC Cancer. 2018; 18: 324. de AbreuPM ACG AzevedoPL do ValleIB de OliveiraKG GouveaSA Cordeiro-SilvaMF LouroID de PodestáJRV LenziJ Frequency of HPV in oral cavity squamous cell carcinoma BMC Cancer 2018 18 324 10.1186/s12885-018-4247-3587052429580212 Search in Google Scholar

Tang KD, Baeten K, Kenny L, Frazer IH, Scheper G, Punyadeera C. Unlocking the potential of saliva-based test to detect HPV-16-driven oropharyngeal cancer. Cancers. 2019; 11: 473. TangKD BaetenK KennyL FrazerIH ScheperG PunyadeeraC Unlocking the potential of saliva-based test to detect HPV-16-driven oropharyngeal cancer Cancers 2019 11 473 10.3390/cancers11040473652116330987261 Search in Google Scholar

Polecane artykuły z Trend MD

Zaplanuj zdalną konferencję ze Sciendo