Otwarty dostęp

Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR

  
28 cze 2021

Zacytuj
Pobierz okładkę

Figure 1

A distribution of MRSA among patients
A distribution of MRSA among patients

Figure 2

The FAM channel of real-time PCR runs for the three specimens, and two controls (negative control and positive control). The progress of the amplification was shown by the three colored curves, one of which was positive control (red curve) and the other was positive results for the mecA gene (MRSA), and the two lines that appeared below the threshold line represent negative results for the mecA gene and the negative control
The FAM channel of real-time PCR runs for the three specimens, and two controls (negative control and positive control). The progress of the amplification was shown by the three colored curves, one of which was positive control (red curve) and the other was positive results for the mecA gene (MRSA), and the two lines that appeared below the threshold line represent negative results for the mecA gene and the negative control

Real-time PCR test sensitivity, specificity, accuracy, and predictive values were measured in 142 MRSA and 34 control subjects

True positive* False negative* True negative* False positive* Sensitivity* Specificity* Accuracy* Predictive value of positive result* Predictive value of negative result*
138 4 34 0 97% 100% 98% 100% 89%

Primers and probes sequence data applied in current research for real-time PCR resistotyping of S_ aureus

Target gene symbol

Primer and probe sequences 5ʹ

Nucleotide positions Aliases Product size (BasePair) Source
nuc Forward primer:GTTGATACACCTGAAACAAAGCA 352-374 SAR0847 156 Current study
Reverse primer:CGCTAAGCCACGTCCATATTTAT 507-485
Probe:VIC-GGTCCTGAAGCAAGTGCATT-BHQ1 400-419
mecA Forward primer:GGAATGCAGAAAGACCAAAGC 406-426 SABB_RS00325 126 Current study
Reverse primer:CTTTGGAACGATGCCTATCTCA 531-510
Probe:FAM-TGGCCAATACAGGAACAGCA-BHQ1 488-507
Język:
Angielski
Częstotliwość wydawania:
4 razy w roku
Dziedziny czasopisma:
Nauki biologiczne, Biologia molekularna, Biochemia