Accesso libero

Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR

Sabah Saad Abdulsahib

Sabah Saad Abdulsahib

Biomedical Engineering Department, University of Technology - IraqBaghdad, Iraq
Cerca questo autore su
Sciendo|Google Scholar
Abdulsahib, Sabah Saad
  
28 giu 2021
Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Pubblicato online: 28 giu 2021
Pagine: 86 - 92
Ricevuto: 08 mag 2021
Accettato: 29 mag 2021
DOI: https://doi.org/10.2478/acb-2021-0012
Parole chiave
© 2021 Sabah Saad Abdulsahib, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

A distribution of MRSA among patients
A distribution of MRSA among patients

Figure 2

The FAM channel of real-time PCR runs for the three specimens, and two controls (negative control and positive control). The progress of the amplification was shown by the three colored curves, one of which was positive control (red curve) and the other was positive results for the mecA gene (MRSA), and the two lines that appeared below the threshold line represent negative results for the mecA gene and the negative control
The FAM channel of real-time PCR runs for the three specimens, and two controls (negative control and positive control). The progress of the amplification was shown by the three colored curves, one of which was positive control (red curve) and the other was positive results for the mecA gene (MRSA), and the two lines that appeared below the threshold line represent negative results for the mecA gene and the negative control

Real-time PCR test sensitivity, specificity, accuracy, and predictive values were measured in 142 MRSA and 34 control subjects

True positive* False negative* True negative* False positive* Sensitivity* Specificity* Accuracy* Predictive value of positive result* Predictive value of negative result*
138 4 34 0 97% 100% 98% 100% 89%

Primers and probes sequence data applied in current research for real-time PCR resistotyping of S_ aureus

Target gene symbol

Primer and probe sequences 5ʹ 3ʹ

 Nucleotide positions Aliases Product size (BasePair) Source
nuc Forward primer:GTTGATACACCTGAAACAAAGCA 352-374 SAR0847 156 Current study
Reverse primer:CGCTAAGCCACGTCCATATTTAT 507-485
Probe:VIC-GGTCCTGAAGCAAGTGCATT-BHQ1 400-419
mecA Forward primer:GGAATGCAGAAAGACCAAAGC 406-426 SABB_RS00325 126 Current study
Reverse primer:CTTTGGAACGATGCCTATCTCA 531-510
Probe:FAM-TGGCCAATACAGGAACAGCA-BHQ1 488-507
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Biologia molecolare, Buiochimica
Feed RSS della rivista