<abstract xmlns="http://www.w3.org/1999/xhtml"><p>The methicillin-resistant <italic>Staphylococcus aureus</italic> (MRSA) is a significant human pathogenic bacterium that is endemic within hospitals around the world. The identification and inspection of MRSA in clinical samples is quite helpful both in advising individual patients about the required care and in tracking these species. The goal of this study was to present a modern, faster, and more accurate diagnostic technique to operate on the real-time duplex PCR applicable to <italic>S. aureus</italic>/MRSA monitoring in Iraqi patients. For this reason, the <italic>S. aureus</italic>-specific <italic>nuc</italic> gene sequence and the <italic>mecA</italic> gene sequence were checked simultaneously. To estimate the assay efficiency, a set of six target strains, 34 non-target strains, and 296 clinical specimens were used. The findings obtained from the diagnosis of a total of 296 isolates based on phenotypic characteristics and biochemical tests showed that 146 (49.32%) were classified as individuals with respiratory tract infections of <italic>S. aureus</italic> with a total male to female ratio of 1.47, and 142 isolates demonstrated methicillin resistance. 142 MRSA isolates were investigated in the molecular analysis, all MRSA isolates had positive results for the <italic>nuc</italic> gene and 138 isolates were positive for the <italic>mecA</italic> gene. The current real-time PCR assay has 97% sensitivity, 100% specificity, and 98% accuracy.</p><p><bold>Running title</bold>: Identification of the MRSA by real time PCR</p></abstract>

The methicillin-resistant Staphylococcus aureus (MRSA) is a significant human pathogenic bacterium that is endemic within hospitals around the world. The identification and inspection of MRSA in clinical samples is quite helpful both in advising individual patients about the required care and in tracking these species. The goal of this study was to present a modern, faster, and more accurate diagnostic technique to operate on the real-time duplex PCR applicable to S. aureus/MRSA monitoring in Iraqi patients. For this reason, the S. aureus-specific nuc gene sequence and the mecA gene sequence were checked simultaneously. To estimate the assay efficiency, a set of six target strains, 34 non-target strains, and 296 clinical specimens were used. The findings obtained from the diagnosis of a total of 296 isolates based on phenotypic characteristics and biochemical tests showed that 146 (49.32%) were classified as individuals with respiratory tract infections of S. aureus with a total male to female ratio of 1.47, and 142 isolates demonstrated methicillin resistance. 142 MRSA isolates were investigated in the molecular analysis, all MRSA isolates had positive results for the nuc gene and 138 isolates were positive for the mecA gene. The current real-time PCR assay has 97% sensitivity, 100% specificity, and 98% accuracy.Running title: Identification of the MRSA by real time PCR

Identification of the respiratory tract infection due to methicillin-resistant <italic>Staphylococcus aureus</italic> by TaqMan real-time PCR

Medical Journal of Cell Biology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Identification of the respiratory tract infection due to methicillin-resistant  by TaqMan real-time PCR

The methicillin-resistant Staphylococcus aureus (MRSA) is a significant human pathogenic bacterium that is endemic within hospitals around the world. The...

Target gene symbol	Primer and probe sequences 5ʹ 3ʹ	Nucleotide positions	Aliases	Product size (BasePair)	Source
nuc	Forward primer:GTTGATACACCTGAAACAAAGCA	352-374	SAR0847	156	Current study
	Reverse primer:CGCTAAGCCACGTCCATATTTAT	507-485
	Probe:VIC-GGTCCTGAAGCAAGTGCATT-BHQ1	400-419
mecA	Forward primer:GGAATGCAGAAAGACCAAAGC	406-426	SABB_RS00325	126	Current study
	Reverse primer:CTTTGGAACGATGCCTATCTCA	531-510
	Probe:FAM-TGGCCAATACAGGAACAGCA-BHQ1	488-507

Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR

Publicado en línea: 28 jun 2021

Páginas: 86 - 92

Recibido: 08 may 2021

Aceptado: 29 may 2021

DOI: https://doi.org/10.2478/acb-2021-0012

Palabras clave
Staphylococci, antibiotype, antibiotic resistance genes, real-time PCR

© 2021 Sabah Saad Abdulsahib, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Figure 2

Real-time PCR test sensitivity, specificity, accuracy, and predictive values were measured in 142 MRSA and 34 control subjects

Primers and probes sequence data applied in current research for real-time PCR resistotyping of S. aureus

Identification of the respiratory tract infection due to methicillin-resistant Staphylococcus aureus by TaqMan real-time PCR

Publicado en línea: 28 jun 2021

Páginas: 86 - 92

Recibido: 08 may 2021

Aceptado: 29 may 2021

DOI: https://doi.org/10.2478/acb-2021-0012

Palabras claveStaphylococci, antibiotype, antibiotic resistance genes, real-time PCR

© 2021 Sabah Saad Abdulsahib, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Figure 2

Real-time PCR test sensitivity, specificity, accuracy, and predictive values were measured in 142 MRSA and 34 control subjects

Primers and probes sequence data applied in current research for real-time PCR resistotyping of S. aureus

Palabras clave
Staphylococci, antibiotype, antibiotic resistance genes, real-time PCR