Accesso libero

In vitro and in vivo activity of Lactobacillus sakei L14 strain against Campylobacter jejuni DC3 strain

John Roybert P. Catacutan
John Roybert P. Catacutan
, 
Ma. Socorro Edden P. Subejano
Ma. Socorro Edden P. Subejano
 e 
Gil M. Penuliar
Gil M. Penuliar
   | 25 mar 2022
Journal of Veterinary Research's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Pubblicato online: 25 mar 2022
Pagine: 85 - 94
Ricevuto: 12 set 2021
Accettato: 06 mar 2022
DOI: https://doi.org/10.2478/jvetres-2022-0015
Parole chiave
© 2022 J.R.P. Catacutan et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Primary screening results of putative exogenous lactic acid bacteria with inhibitory activity against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error
Primary screening results of putative exogenous lactic acid bacteria with inhibitory activity against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Fig. 2

Secondary screening results of putative exogenous lactic acid bacteria against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error
Secondary screening results of putative exogenous lactic acid bacteria against Campylobacter jejuni DC3 and C. jejuni ATCC 33560. Error bars represent standard error

Fig. 3

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14-only cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error
Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14-only cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Fig. 4

Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14 co-cultured with C. jejuni DC3 cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error
Growth curve of Campylobacter jejuni DC3 grown in Lactobacillus sakei L14 co-cultured with C. jejuni DC3 cell-free supernatant (CFS) from 3 different timepoints (24, 48, and 72 h) and 5 different proportions (0%, 12.5%, 25%, 50%, 100%), based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error

Fig. 5

Growth curve of Campylobacter jejuni DC3 in neutralised Lactobacillus sakei L14 only and neutralised L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) indicated no significant difference across all treatments for both types of CFS
Growth curve of Campylobacter jejuni DC3 in neutralised Lactobacillus sakei L14 only and neutralised L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) indicated no significant difference across all treatments for both types of CFS

Fig. 6

Growth curve of Campylobacter jejuni DC3 in heat-treated Lactobacillus sakei L14 only and L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) and post-hoc Tukey’s Honestly Significant Difference test indicated significant differences between 0 and 50% and 0 and 100% proportions for both types of CFS
Growth curve of Campylobacter jejuni DC3 in heat-treated Lactobacillus sakei L14 only and L. sakei L14 with C. jejuni DC3 cell-free supernatant (CFS) from a single timepoint (72 h) and in 3 different proportions, based on absorbance readings (optical density (OD) 600 nm). Error bars represent standard error. Analysis of variance (α = 0.05) and post-hoc Tukey’s Honestly Significant Difference test indicated significant differences between 0 and 50% and 0 and 100% proportions for both types of CFS

Primers used in this study

Primer Sequence (5′-3′) PCR product (bp) Target organism Reference
MD16S1-F ATCTAATGGCTTAACCATTAAAC 857 Campylobacter spp. (10)
MD16S2-R GGACGGTAACTAGTTTAGTATT 589 C. jejuni
MDmapA1-F CTATTTTATTTTTGAGTGCTTGTG
MDmapA2-R GCTTTATTTGCCATTTGTTTTATTA
L15f GCTCAGGAYGAACGCYGG 750 lactic acid bacteria (9)
L687r CACCGCTACACATGRADTTC
lsF GAGCTTGCTCCTCATTGATAA
lsR TTGGATACCGTCACTACCTG 434 Lactobacillus sakei (17)

Campylobacter spp. detection results from pooled faecal samples

Group Days post infection
pre 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31
1 - - - - - - - - - - - - - - - - -
2 - - - - - - - + - - - - - - - - -
3 - - - + - - + + - - - + + + - + +
4 - - - - - - - - - - - - - - - - -

Lactobacillus sakei L14 PCR detection results from pooled faecal samples

Group Days post infection
pre 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31
1 - - - - - - - - - - - - - - - - -
2 - - - - - - - - - - - - - - - - -
3 - + - - - - - + - - + + - - - - -
4 - + - - - - - - - - + + + + - - -

Lactic acid bacteria PCR detection results from pooled faecal samples

Group Days post infection
pre 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31
1 + + + + + + + + + + + + + + + + +
2 + + + + + + + + + + + + + + + + +
3 + + + + + + + + + + + + + + + + +
4 + + + + + + + + + + + + + + + + +

Campylobacter spp. PCR detection results from individual gut samples at 33 days post infection

Group Sample
A B C D
1 - - - n/a
2 - - - n/a
3 + + + +
4 - - - -

Optimised PCR conditions used in this study adapted from Subejano & Penuliar (26)

PCR step MD16S1-F / MD16S2-R MDmapA1-F / MDmapA2-R L15f / L687r lsF / lsR Number of cycles
Initial denaturation 95°C, 2 min 95°C, 2 min 95°C, 2 min 95°C, 2 min 1
Denaturation 95°C, 1 min 95°C, 1 min 95°C, 1 min 95°C, 1 min
Annealing 49°C, 1 min 53°C, 1 min 60°C, 1 min 60°C, 1 min 35
Extension 72°C, 1 min 72°C, 1 min 72°C, 1 min 72°C, 1 min
Final extension 72°C, 5 min 72°C, 5 min 72°C, 5 min 72°C, 5 min 1
eISSN:
2450-8608
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine
Feed RSS della rivista