<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec><h3>Introduction</h3>
<p>In recent years, colistin-resistant <italic>Acinetobacter baumannii</italic> (<italic>A. baumannii</italic>) has been found all over the world. In this current study, the main purpose was to examine the occurrence of extensively drug resistant (XDR), resistance to colistin and characterization and mutations in <italic>pmrCAB</italic> genes among <italic>A. baumannii</italic> obtained from inpatients.</p>
</sec>
<sec><h3>Materials and Methods</h3>
<p>A total of 108 clinical isolates of <italic>A. baumannii</italic> were collected from several hospitals located in Isfahan, Iran. The Kirby-Bauer assay was performed to assess the antimicrobial resistance. The Phoenix automated system was utilized to determine the minimum inhibitory concentration (MIC) of colistin for each of the bacterial isolates. Polymerase chain reaction was used to screen for <italic>pmrCAB</italic> genes that mediate colistin resistance, and sequencing was used to determine the amplicon’s nucleotide sequence.</p>
</sec>
<sec><h3>Results</h3>
<p>The results revealed that all A. baumannii isolates (100%) were resistant to piperacillin tazobactam, meropenem and ciprofloxacin. All isolates were classified as XDR, with seven isolates being pan-drug resistant (PDR). Colistin resistance (CoR) was found in 6.48% (7/108) of studied isolates, all of which were positive for <italic>pmrCAB</italic> genes. The sequencing results showed a substitution in <italic>pmrB</italic> and two isolates showed a substitution in <italic>pmrC</italic>.</p>
</sec>
<sec><h3>Conclusions</h3>
<p>In conclusion, this study is the initial report of the existence and mutations of <italic>pmrB</italic> and C genes in the clinical isolate of <italic>A. baumannii</italic> in our region. This outcome highlights the necessity to explore additional mutations in the PMR operon of <italic>A. baumannii</italic> in forthcoming studies. Moreover, our results highlight the high occurrence of XDR-<italic>A. baumannii</italic> strain in Isfahan, Iran.</p>
</sec>
</abstract>

Introduction
In recent years, colistin-resistant Acinetobacter baumannii (A. baumannii) has been found all over the world. In this current study, the main purpose was to examine the occurrence of extensively drug resistant (XDR), resistance to colistin and characterization and mutations in pmrCAB genes among A. baumannii obtained from inpatients.

Materials and Methods
A total of 108 clinical isolates of A. baumannii were collected from several hospitals located in Isfahan, Iran. The Kirby-Bauer assay was performed to assess the antimicrobial resistance. The Phoenix automated system was utilized to determine the minimum inhibitory concentration (MIC) of colistin for each of the bacterial isolates. Polymerase chain reaction was used to screen for pmrCAB genes that mediate colistin resistance, and sequencing was used to determine the amplicon’s nucleotide sequence.

Results
The results revealed that all A. baumannii isolates (100%) were resistant to piperacillin tazobactam, meropenem and ciprofloxacin. All isolates were classified as XDR, with seven isolates being pan-drug resistant (PDR). Colistin resistance (CoR) was found in 6.48% (7/108) of studied isolates, all of which were positive for pmrCAB genes. The sequencing results showed a substitution in pmrB and two isolates showed a substitution in pmrC.

Conclusions
In conclusion, this study is the initial report of the existence and mutations of pmrB and C genes in the clinical isolate of A. baumannii in our region. This outcome highlights the necessity to explore additional mutations in the PMR operon of A. baumannii in forthcoming studies. Moreover, our results highlight the high occurrence of XDR-A. baumannii strain in Isfahan, Iran.

Molecular mechanisms of colistin resistance mediated by <italic>pmrCAB</italic> genes in <italic>Acinetobacter baumannii</italic> isolated from patients hospitalized in Isfahan medical centers

Faculty of Biological Sciences and Technology Shahid Ashrafi Esfahani University

Department of Microbiology, Science and Research Branch

Postępy Higieny i Medycyny Doświadczalnej

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Molecular mechanisms of colistin resistance mediated by  genes in  isolated from patients hospitalized in Isfahan medical centers

Introduction
In recent years, colistin-resistant Acinetobacter baumannii (A. baumannii) has been found all over the world. In this current study, the main...

Primer	Primer sequence (5ʹ to 3ʹ)	Amplicon size	Annealing temperature
PmrA(F)	GATGGTTTAAATTTGGGTGCAGAT	120	58
PmrA(R)	TTGACTCGCAAGTTGAGCTTCT	120	58
PmrB(F)	GCCATTATTCGTCGTGGTTTAAA	150	57
PmrB(R)	GCGCTCAAAAAGACGGTTCA	150	57
PmrC(F)	CCATTTGGCTAGGTGCAATTT	132	57
PmrC(R)	CCGCATAATAGGTAGCAACAAG	132	57

Molecular mechanisms of colistin resistance mediated by pmrCAB genes in Acinetobacter baumannii isolated from patients hospitalized in Isfahan medical centers

Article Category: Original Study

Publicado en línea: 28 abr 2024

Páginas: 52 - 57

Recibido: 02 jun 2023

Aceptado: 10 ene 2024

DOI: https://doi.org/10.2478/ahem-2024-0002

Palabras clave
MDR, XDR, colistin resistance,

© 2024 Ali Abbasi et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1.

Figure 2

Oligonucleotide sequences used in this study

Molecular mechanisms of colistin resistance mediated by pmrCAB genes in Acinetobacter baumannii isolated from patients hospitalized in Isfahan medical centers

Article Category: Original Study

Publicado en línea: 28 abr 2024

Páginas: 52 - 57

Recibido: 02 jun 2023

Aceptado: 10 ene 2024

DOI: https://doi.org/10.2478/ahem-2024-0002

Palabras claveMDR, XDR, colistin resistance,

© 2024 Ali Abbasi et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1.

Figure 2

Oligonucleotide sequences used in this study

Palabras clave
MDR, XDR, colistin resistance,