Open Access

Dynamics of Antimicrobial Susceptibility and Risk Factors Associated with Infections Caused by Colistin-Resistant Bacteria: A Study from the Northern Region of Haryana, India

Shubham Chauhan

Shubham Chauhan

Department of Microbiology, Maharishi Marksandeshwar Institute of Medical Science and Research, Maharishi Markandeshwar (Deemed to be) UniversityAmbala, India
Search for this author on
Sciendo|Google Scholar
Chauhan, Shubham
, 
Pottathil Shinu

Pottathil Shinu

Department of Biomedical Sciences, College of Clinical Pharmacy, King Faisal UniversityAl-Ahsa, Saudi Arabia
Orcid profile
Search for this author on
Sciendo|Google Scholar
Shinu, Pottathil
, 
Narinder Kaur

Narinder Kaur

Department of Microbiology, Maharishi Marksandeshwar Institute of Medical Science and Research, Maharishi Markandeshwar (Deemed to be) UniversityAmbala, India
Search for this author on
Sciendo|Google Scholar
Kaur, Narinder
, 
Adesh K. Saini

Adesh K. Saini

Department of Biotechnology, Maharishi Markandeshwar Engineering College, Maharishi Markandeshwar (Deemed to be) UniversityAmbala, India
Search for this author on
Sciendo|Google Scholar
Saini, Adesh K.
, 
Rosy Bala

Rosy Bala

Department of Microbiology, Maharishi Marksandeshwar Institute of Medical Science and Research, Maharishi Markandeshwar (Deemed to be) UniversityAmbala, India
Search for this author on
Sciendo|Google Scholar
Bala, Rosy
, 
Anroop B. Nair

Anroop B. Nair

Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal UniversityAl-Ahsa, Saudi Arabia
Search for this author on
Sciendo|Google Scholar
Nair, Anroop B.
, 
Aminur Rahman

Aminur Rahman

Department of Biomedical Sciences, College of Clinical Pharmacy, King Faisal UniversityAl-Ahsa, Saudi Arabia
Search for this author on
Sciendo|Google Scholar
Rahman, Aminur
 and 
Mohamed A. Morsy

Mohamed A. Morsy

Department of Pharmaceutical Sciences, College of Clinical Pharmacy, King Faisal UniversityAl-Ahsa, Saudi Arabia
Search for this author on
Sciendo|Google Scholar
Morsy, Mohamed A.
  
Mar 26, 2025
Dynamics of Antimicrobial Susceptibility and Risk Factors Associated with Infections Caused by Colistin-Resistant Bacteria: A Study from the Northern Region of Haryana, India's Cover Image
About this article
Previous Article
Next Article
Cite
Download Cover
Article Category: ORIGINAL PAPER
Published Online: Mar 26, 2025
Page range: 95 - 105
Received: Aug 19, 2024
Accepted: Feb 05, 2025
DOI: https://doi.org/10.33073/pjm-2025-008
Keywords
© 2025 Shubham Chauhan et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
undefined

Fig. 1.

Broth microdilution method for the detection of colistin-resistant bacteria. Vertical Lane A is a negative control, B is an in-house positive control, and C-H is processed bacteria for the identification of colistin resistance, while horizontal lanes from 1–8 show the dilution of colistin sulfate from 0.5 μg/ml to 16 μg/ml, lane 7 is growth control and 8 is media control.
Broth microdilution method for the detection of colistin-resistant bacteria. Vertical Lane A is a negative control, B is an in-house positive control, and C-H is processed bacteria for the identification of colistin resistance, while horizontal lanes from 1–8 show the dilution of colistin sulfate from 0.5 μg/ml to 16 μg/ml, lane 7 is growth control and 8 is media control.

Fig. 2.

Identification of mcr 1–5 genes in colistin-resistant Gram-negative bacteria by multiplex PCR. Bacterial plasmid DNA was isolated by boiling method and the mcr 1–5 genes were identified by multiplex PCR and further visualized by gel electrophoresis. Lane (L): 50 bp ladder; Lane (1, 2, 3, 4, 5): samples; Lane (6): negative control; Lane (7): positive control.
Identification of mcr 1–5 genes in colistin-resistant Gram-negative bacteria by multiplex PCR. Bacterial plasmid DNA was isolated by boiling method and the mcr 1–5 genes were identified by multiplex PCR and further visualized by gel electrophoresis. Lane (L): 50 bp ladder; Lane (1, 2, 3, 4, 5): samples; Lane (6): negative control; Lane (7): positive control.

Fig. 3.

Flowchart showing the study schedule. *MDR – multidrug resistance, **PCR – polymerase chain reaction
Flowchart showing the study schedule. *MDR – multidrug resistance, **PCR – polymerase chain reaction

Fig. 4.

Distribution of multidrug-resistant Gram-negative bacilli isolated from different clinical specimens collected across various inpatient departments.
Distribution of multidrug-resistant Gram-negative bacilli isolated from different clinical specimens collected across various inpatient departments.

Antibiotic sensitivity pattern of colistin-resistant bacteria (n = 57)_

Antibiotics Escherichia coli (n = 16) (%) Klebsiella pneumoniae (n = 13) (%) Pseudomonas aeruginosa (n = 19) (%) Acinetobacter spp. (n = 8) (%) Citrobacter freundii (n = 1) (%)
Amoxicillin/clavulanic acid 7 (44%) 1 (8%) ND ND –
Piperacillin/tazobactam 5 (31%) – 6 (32%) 1 (17%) 1 (100%)
Cefotaxime 1 (6%) – – ND –
Ceftriaxone 2 (13%) – 3 (16%) – 1 (100%)
Cefepime 2 (13%) – 1 (5%) – ND
Imipenem – – – – –
Meropenem 3 (9%) – 2 (11%) 4 (50%) –
Gentamicin 8 (50%) 5 (38%) 7 (37%) 2 (33%) –
Amikacin 13 (81%) 5 (38%) 10 (53%) 6 (86%) 1 (100%)
Ciprofloxacin 3 (19%) 1 (8%) 2 (11%) 1 (14%) –
Cotrimoxazole 10 (63%) 4 (30%) 0 1 (13%) –

The primers used for the targeted gene_

Sr. No. mcr genes Amplicon size (bp) Primer sequences (5’–3’)*
1. mcr-1 320 F: AGTCCGTTTGTTCTTGTGGCR: AGATCCTTGGTCTCGGCTTG
2. mcr-2 700 F: CAAGTGTGTTGGTCGCAGTTR: TCTAGCCCGACAAGCATACC
3. mcr-3 900 F: AAATAAAAATTGTTCCGCTTATGR: AATGGAGATCCCCGTTTTT
4. mcr-4 1,100 F: TCACTTTCATCACTGCGTTGR: TTGGTCCATGACTACCAATG
5. mcr-5 1,644 F: ATGCGGTTGTCTGCATTTATCR: TCATTGTGGTTGTCCTTTTCTG

Antibiotic-resistance rate (in percentage) among multidrug-resistant Gram-negative bacilli_

Antibiotics Escherichia coli (n = 481) (%) Klebsiella pneumoniae (n = 265) (%) Klebsiella oxytoca (n = 15) (%) Pseudomonas aeruginosa (n = 157) (%) Pseudomonas spp. (n = 06) (%) Acinetobacter spp. (n = 70) (%) Citrobacter freundii (n = 1) (%)
Amoxycillin/Clavulanic acid 257 (53%) 189 (71%) 13 (87%) ND ND ND ND
Piperacillin/tazobactam 200 (42%) 176 (66%) 12 (80%) 85 (54%) 4 (67%) 62 (89%) –
Cefotaxime 455 (95%) 251 (94%) 14 (93%) 24 (86 ND* 7 (88%) 1 (100%)
Ceftriaxone 405 (84%) 239 (90%) 13 (87%) 110 (70%) 4 (67%) 59 (84%) –
Cefepime 93 (78%) 198 (75%) 14 (93%) 115 (73%) 4 (67%) 65 (93%) ND
Imipenem 399 (82%) 223 (84%) 11 (73%) 104 (66%) 5 (83%) 68 (97%) 1 (100%)
Meropenem 193 (40%) 127 (48%) 8 (53%) 82 (52%) 4 (67%) 57 (81%) 1 (100%)
Gentamicin 218 (45%) 150 (7%) 8 (53%) 79 (50%) 4 (67%) 60 (86%) 1 (100%)
Amikacin 79 (16%) 85 (32%) 8 (53%) 72 (46%) 4 (67%) 36 (51%) –
Ciprofloxacin 450 (94%) 229 (86%) 14 (93%) 110 (70%) 5 (83%) 68 (97%) 1 (100%)
Cotrimoxazole 257 (53%) 175 (66%) 09 (60%) 143 (91%) 05 (83%) 59 (84%) –

Determination of colistin minimum inhibitory concentration (MICs) of different MDR Gram-negative isolates by Broth Micro Dilution method_

MICs of colistin (n = 995) Klebsiella spp. (n = 280) (%) Escherichia coli (n = 481) (%) Pseudomonas spp. (n = 163) (%) Acinetobacter spp. (n = 70) (%) Citrobacter freundii (n = 1) (%)
≤ 0.5 μg/ml 207 (74%) 415 (86%) 99 (61%) 28 (40%) –
1 μg/ml 17 (6%) 23 (5%) 36 (22%) 30 (43%) –
2 μg/ml 43 (16%) 27 (6%) 09 (6%) 04 (6%) –
4 μg/ml 09 (3%) 06 (1%) 17 (10%) 06 (9%) 01 (100%)
8 μg/ml 03 (1%) 6 (1%) 01 (0.61%) 01 (1%) –
≥ 16 μg/ml 01 (0.36%) 04 (0.82%) 01 (0.61%) 01 (14%) –

Demographic characteristics and risk factors associated with colistin-resistant Gram-negative bacteria_

Demographic characteristics MDR-GNB (n = 995) (%) Colistin resistance (n = 57) (%) Level of significance (Chi-square test)
Age (years) 0–20 years 64 (6%) 08 (13%) 0.0816
21–40 years 279 (28%) 15 (5%)
41–60 years 361 (36%) 23 (6%)
Above 60 years 291 (29%) 11 (4%)
Gender Male 602 (61%) 46 (8%) 0.2439
Female 393 (39%) 11 (3%)
Residence Rural 724 (73%) 40 (6%) 0.6699
Urban 271 (27%) 17 (6%)
Education aIntermediate level 530 (55%) 47 (9%) < 0.0001
bUndergraduate level 357 (37%) 06 (2%)
cGraduate level or higher 108 (6%) 01 (2%)
Risk factors associated with colistin resistance
Duration of hospital stay Less than 48 h 19(2%) – < 0.001***
2–5 days 99 (10%) –
5–15 days 368 (37%) 1 (2%)
> 15 days 509 (51%) 56 (98%)
History of previous hospitalization for more than 5 days with beta-lactam antibiotics 448 (45%) 41 (72%) 0.0264*
Diabetes 278 (28%) 32 (56%) 0.0021**
Chronic heart disease (CHD) 139 (14%) 1 (2%) 0.0151*
Chronic obstructive pulmonary disease (COPD) 265 (27%) 11 (19 %) 0.0061**
Chronic renal disease (CRD) 129 (13%) 4 (7%) 0.2358

Distribution of multidrug resistance and colistin-resistant Gram-negative bacilli in various samples_

Specimens Gram-negative isolates (n = 2,237) (%) *MDR GNB (n = 995) (%) Colistin resistant bacteria (n = 57) (%)
Blood 402 (18%) 112 (28%) 9 (8%)
Sputum 419 (19%) 151 (36%) 9 (6%)
Urine 811 (34%) 560 (69%) 25 (4%)
Wound swab 165 (10% 32 (19%) 2 (6%)
Pus 322 (14%) 137 (43%) 12 (9%)
Endotracheal swab 46 (2%) 02 (4%) –
Vaginal Swab 72 (3%) 01 (1%) –
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Microbiology and Virology
Journal RSS Feed