Dynamics of Antimicrobial Susceptibility and Risk Factors Associated with Infections Caused by Colistin-Resistant Bacteria: A Study from the Northern Region of Haryana, India
Article Category: ORIGINAL PAPER
Published Online: Mar 26, 2025
Page range: 95 - 105
Received: Aug 19, 2024
Accepted: Feb 05, 2025
DOI: https://doi.org/10.33073/pjm-2025-008
Keywords
© 2025 Shubham Chauhan et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Antimicrobial resistance (AMR) has become a “hidden epidemic” due to the lack of new antimicrobial medication breakthroughs. AMR is receiving the highest priority and attention from the World Health Organization due to its growing importance as a global health concern (Ferrara et al. 2024). Colistin is frequently used as a last-resort antibiotic to treat infections caused by multidrug-resistant Gram-negative bacterial infections (MDR-GNB), mainly when the bacteria are resistant to carbapenem. The possible cause of colistin resistance in bacteria may be due to chromosomal mutations, which often cause changes in the target site of lipopolysaccharides (LPS), or it can also occur through the transfer of plasmids carrying
Colistin is a growth stimulant often used in the cattle, poultry, and aquaculture industries, leading to its widespread dissemination in the environment. This leads to the selection and proliferation of bacteria resistant to colistin, which may infect human beings as well (Gharaibeh and Shatnawi 2019). Literature indicates that the prevalence of colistin resistance was relatively low (Chauhan et al. 2022). Nevertheless, antibiotic misuse and overprescription are considered the primary cause of the development of antimicrobial resistance. Further, the ease with which antibiotics can be acquired over the counter exacerbates the problem of antibiotic abuse, resulting in the emergence of antibiotic resistance (Mithuna et al. 2024). The several risk factors that can lead to the development of colistin resistance include colistin usage, previous colistin use, age of the patient, patients undergoing surgical procedures, duration of stay in ICUs, use of monobactams, and use of antifungal agents (Yau et al. 2009; Sharma et al. 2022). Further, the prevalence of colistin resistance among Gram-negative bacteria varies widely depending on the geographic area, duration, antimicrobial susceptibility dynamics, and method of antimicrobial testing. In this study, we hypothesized that the prevalence of colistin resistance in MDR-GNB would be significantly higher in our study population than in the domestic and global average. In addition, demographic factors like age, gender, residence, and educational level would significantly impact the prevalence of colistin resistance in MDR-GNB. Additionally, the presence of underlying comorbidities like diabetes, chronic kidney disease, or chronic obstructive pulmonary diseases would be linked to a higher risk of colistin-resistant MDR-GNB infections. To our knowledge, this is the first study investigating the risk factors and antimicrobial susceptibility dynamics from the Northern region of Haryana, India. In light of the above factors, we undertook a study to examine the dynamics of antimicrobial susceptibility and identify various risk factors associated with infections caused by colistin-resistant bacteria within our study settings.
A descriptive, cross-sectional, and observational study was carried out in the Department of Microbiology, Maharishi Markandeshwar Institute of Medical Science and Research, Ambala, India. The study was carried out in the department from May 2021 to September 2022. Informed consent was recorded at the time of specimen collection. Other demographic details such as gender, age, co-morbidities, unit/ward of the patient, duration of hospital stay, antibiotics intake, and use of invasive devices were also noted.
Samples, including pus, blood, sputum, urine, and wound swabs, were collected from every clinic and department of the constituent hospital of Maharishi Markandeshwar Institute of Medical Science and Research. We excluded duplicate samples from the current study, including repetitions or those collected from the same patients. Further, sample collection from a single hospital ensured a controlled environment with consistent data collection procedures and minimized variability in clinical practices, further enhancing the study’s internal validity. However, using data from just one hospital limits the generalizability of the findings, as the results may not be fully representative of other healthcare settings with different patient demographics, regional health trends, or hospital protocols. Subsequently, these samples underwent standard direct microscopy and bacteriological culture in the hospital’s microbiology laboratory. All the clinical samples were subjected to Gram staining (except the blood sample). At the same time, urine was microscopically prepared (a wet mount of uncentrifuged urine) and observed to detect the pus cells and bacteria. All specimens were inoculated on blood agar and MacConkey agar and incubated at 37°C for 18–24 hours. Blood samples were incubated at 37°C in the BACTEC™ 9050 (Becton, Dickinson and Company, USA) system for five days and processed per the standard laboratory protocols (Isenberg 2004). The identification of Gram-positive and Gram-negative bacteria were performed using VITEK® 2 GP-ID cards (bioMérieux, France) and VITEK® 2 GN-ID cards (bioMérieux, France), respectively. The results were also confirmed through microscopy, colony characteristics, and biochemical tests, following standard microbiological protocols (Isenberg 2004).
In the current study, VITEK® 2 was used to conduct the antibiotic susceptibility testing, however, an agar disk diffusion method (Kirby-Bauer disk diffusion) was also performed parallelly to ensure consistency in automated testing. Further, any discrepant results from VITEK® 2 were primarily resolved using the Kirby-Bauer disk diffusion method. 0.5 McFarland standard was used to standardize the turbidity of bacterial suspensions. Mueller-Hinton Agar was used to perform the agar disk diffusion method. All the antibiotic discs were procured from HiMedia Laboratories Pvt. Ltd. (India). The tested antibiotics included: amoxicillin/clavulanic acid (20/10 μg), piperacillin/tazobactam (100/10 μg), cefotaxime (30 μg), ceftriaxone (30 μg), cefepime (30 μg), imipenem (10 μg), meropenem (10 μg), gentamicin (10 μg), amikacin (30 μg), ciprofloxacin (5 μg), and trimethoprim-sulfamethoxazole/cotrimoxazole (1.25/23.75 μg). Further, this study primarily focused on antibiotics commonly used in our geographical region; therefore, other antibiotic combinations, such as imipenem/relebactam, ceftazidime/avibactam, ceftolozane/tazobactam, aztreonam/avibactam, tigecycline, and chloramphenicol were not included. The VITEK® 2 cards used in the current study include; lactose fermenters (LF) – N-405 (antibiotic tested include: amoxicillin/clavulanic acid, piperacillin/tazobactam, cefuroxime, cefuroxime axetil, ceftriaxone, cefoperazone/sulbactam, cefepime, ertapenem, imipenem, meropenem, amikacin, gentamicin, ciprofloxacin, tigecycline, fosfomycin, colistin, cotrimoxazole), non-lactose fermenters (NLF) – N-406 (antibiotic tested include: piperacillin/tazobactam, ceftazidime, cefoperazone/sulbactam, cefepime, aztreonam, imipenem, meropenem, amikacin, gentamicin, ciprofloxacin, levofloxacin, minocycline, tigecycline, fosfomycin, colistin, cotrimoxazole), and urine – N-235 (antibiotic tested include; ampicillin, amoxicillin/clavulanic acid, ticarcillin, piperacillin/tazobactam, cefalotin, cefoxitin, cefixime, ceftazidime, ceftriaxone, ertapenem, amikacin, gentamicin, naldixic acid, ciprofloxacin, norfloxacin, ofloxacin, fosfomycin, nitrofurantoin, cotrimoxazole). However, for the final analysis, we included only the commonly tested antibiotics against organisms isolated from various samples to ensure consistency in the selection of MDRs. All the tests and the interpretations of the antimicrobial susceptibility testing were performed per the relevant CLSI standards (CLSI 2020). The susceptibility testing of colistin was determined using the broth microdilution (BMD) method with cation-adjusted Mueller Hinton broth (CA-MHB; HiMedia Laboratories Pvt. Ltd. India) (CLSI 2020).
MDR was defined as resistance to at least one antibiotic in three or more different antibiotic classes as recommended by the CDC and ECDC (Magiorakos et al. 2012). Additionally, strains showing the presence of specific resistance mechanisms such as extended-spectrum beta-lactamases, AmpC, or carbapenemase production were included. The isolated multidrug-resistant bacteria were subjected to the detection of colistin resistance by the BMD. The exclusion criteria for this study were as follows: bacterial strains with intrinsic colistin resistance such as
The MIC of colistin was determined in untreated 96-well polystyrene micro-titer plates using the BMD method (MIC range: ≤ 0.5–16 μg/ml). For the preparation of stock solution 12.6 mg (19,000 UN/mg) colistin sulphate salt (HiMedia Laboratories Pvt. Ltd. India) was dissolved in 12.6 ml of sterile distilled water. The master tube was prepared by adding 64 μl colistin solution in 936 μl sterile CA-MHB. Then, 500 μl of CA-MHB was added to each microcentrifuge tube (MCT), and two-fold dilutions were prepared. Then, 25 μl of solution from MCT was added to corresponding wells, which were already containing 50 μl of CA-MHB in each designated well. The bacterial inoculum (0.5 McFarland standard) was prepared in normal saline using the colonies obtained from blood agar. The bacterial inoculum was further diluted to 1:75 (to yield approximately 5 × 104 CFU/ml of concentration), and 25 μl of diluted bacterial inoculum was added to each well. The microtiter plate was further incubated at 37°C for 24 hours. CLSI MIC breakpoints of ≥ 4 μg/ml for colistin-resistance and ≤ 2 μg/ml for intermediate were used for interpreting the MIC of colistin in Enterobacterales,

Broth microdilution method for the detection of colistin-resistant bacteria.
Vertical Lane A is a negative control, B is an in-house positive control, and C-H is processed bacteria for the identification of colistin resistance, while horizontal lanes from 1–8 show the dilution of colistin sulfate from 0.5 μg/ml to 16 μg/ml, lane 7 is growth control and 8 is media control.
Table I shows the primers used for the targeted gene characterization of bacterial isolates in this study. Plasmid DNA was extracted using the boiling method. For the DNA extraction process, a loopful of colonies from the blood culture plate was suspended in 100 μl of sterile TE buffer, boiled for 10 minutes at 100°C, and centrifuged at 600 ×
The primers used for the targeted gene.
Sr. No. | Amplicon size (bp) | Primer sequences (5’–3’)* | |
---|---|---|---|
1. | 320 | F: AGTCCGTTTGTTCTTGTGGC |
|
2. | 700 | F: CAAGTGTGTTGGTCGCAGTT |
|
3. | 900 | F: AAATAAAAATTGTTCCGCTTATG |
|
4. | 1,100 | F: TCACTTTCATCACTGCGTTG |
|
5. | 1,644 | F: ATGCGGTTGTCTGCATTTATC |
– Primer Source (Eurofins Genomics India Pvt. Ltd., India)
For M-PCR, 12.5 μl of Thermo Scientific™ DreamTaq™ Green PCR Master Mix (2X) (Thermo Fisher Scientific Inc., USA), 5 μl of primer mix (0.5 μl of each primer), 2 μl of DNA lysate (Thermo Fisher Scientific Inc., USA), was mixed with 25 μl nuclease-free water in a PCR tube. Thermal cycling for 40 cycles was performed as described earlier (Rebelo et al. 2018). In this study, primers previously reported by Rebelo et al. (2018) were used to identify
The amplified products were electrophoresed on 1.5% agarose gel and stained using ethidium bromide at 130V (Fig. 2).

Identification of
Bacterial plasmid DNA was isolated by boiling method and the
The descriptive analysis of patient demographics, bacterial isolates, antimicrobial susceptibilities, and risk factors for resistance was analyzed using Statistical Package for the Social Sciences software, IBM SPSS Statistics for Windows v28.0 (IBM Corp., USA). The chi-square test was employed to assess the relationship between colistin resistance in GNB and demographic characteristics, as well as associated risk factors. Additionally, the chi-square test was used to compare the frequency distribution of multidrug and colistin resistance among various GNBs. All statistical analyses were executed using GraphPad Prism v6 (GraphPad Software, USA,
The demographic characteristics and risk factors associated with colistin-resistant Gram-negative bacteria are depicted in Fig. 3 and Table II. Patients aged between 41 and 60 were infected with colistin-resistant bacteria compared to those in other age groups when comparing the patients’ age group. Moreover, while comparing the differences between genders, male patients had a more significant percentage of GNB resistant to colistin than females. Additionally, an association between the isolation rate of MDR GNB and colistin resistance was noted among females (

Flowchart showing the study schedule.
*MDR – multidrug resistance, **PCR – polymerase chain reaction
Demographic characteristics and risk factors associated with colistin-resistant Gram-negative bacteria.
Demographic characteristics | MDR-GNB (n = 995) (%) | Colistin resistance (n = 57) (%) | Level of significance (Chi-square test) | |
---|---|---|---|---|
Age (years) | 0–20 years | 64 (6%) | 08 (13%) | 0.0816 |
21–40 years | 279 (28%) | 15 (5%) | ||
41–60 years | 361 (36%) | 23 (6%) | ||
Above 60 years | 291 (29%) | 11 (4%) | ||
Gender | Male | 602 (61%) | 46 (8%) | 0.2439 |
Female | 393 (39%) | 11 (3%) | ||
Residence | Rural | 724 (73%) | 40 (6%) | 0.6699 |
Urban | 271 (27%) | 17 (6%) | ||
Education | aIntermediate level | 530 (55%) | 47 (9%) | < 0.0001 |
bUndergraduate level | 357 (37%) | 06 (2%) | ||
cGraduate level or higher | 108 (6%) | 01 (2%) | ||
Risk factors associated with colistin resistance | ||||
Duration of hospital stay | Less than 48 h | 19(2%) | – | < 0.001*** |
2–5 days | 99 (10%) | – | ||
5–15 days | 368 (37%) | 1 (2%) | ||
> 15 days | 509 (51%) | 56 (98%) | ||
History of previous hospitalization for more than 5 days with beta-lactam antibiotics | 448 (45%) | 41 (72%) | 0.0264* | |
Diabetes | 278 (28%) | 32 (56%) | 0.0021** | |
Chronic heart disease (CHD) | 139 (14%) | 1 (2%) | 0.0151* | |
Chronic obstructive pulmonary disease (COPD) | 265 (27%) | 11 (19 %) | 0.0061** | |
Chronic renal disease (CRD) | 129 (13%) | 4 (7%) | 0.2358 |
– denotes significant differences at
a – Intermediate level – 10 + 2, b – Undergraduate level-Bachelor’s degree,
c – Graduate level –Master’s degree or higher
Out of the 12,652 samples processed, 79% (n = 9,591) were sterile or showed no growth in culture. Conversely, 24% (n = 3,061) showed growth of pathogenic organisms, wherein 7.0% (n = 824) and 18% (n = 2,237) were Gram-positive bacteria and Gram-negative bacteria, respectively. Of 2,237 total Gram-negative bacteria, 45% (n = 995) were MDR-GNB and 56% (n = 1,242) were non-MDR GNB. Table III shows the distribution of multidrug-resistant and colistin-resistant GNB in various samples. The majority (56%) of MDR-GNB isolates were recovered from urine samples, followed by sputum (15%), pus (14%), blood (11%), wound swab (3%), endotracheal aspirate (0.2%), and high vaginal swab (0.01%), respectively. In the current study, 995 MDR GNB isolates were analyzed for colistin resistance across various bacterial species. It was noted that
Distribution of multidrug resistance and colistin-resistant Gram-negative bacilli in various samples.
Specimens | Gram-negative isolates (n = 2,237) (%) | *MDR GNB (n = 995) (%) | Colistin resistant bacteria (n = 57) (%) |
---|---|---|---|
Blood | 402 (18%) | 112 (28%) | 9 (8%) |
Sputum | 419 (19%) | 151 (36%) | 9 (6%) |
Urine | 811 (34%) | 560 (69%) | 25 (4%) |
Wound swab | 165 (10% | 32 (19%) | 2 (6%) |
Pus | 322 (14%) | 137 (43%) | 12 (9%) |
Endotracheal swab | 46 (2%) | 02 (4%) | – |
Vaginal Swab | 72 (3%) | 01 (1%) | – |
MDR GNB – Multidrug resistant Gram-negative bacilli
In the current study, 29% of MDR-GNB were isolated from outpatient department (OPD) patients, while 71% were sourced from the inpatient department. Figure 4 illustrates the distribution of MDR-GNB isolated from different clinical specimens collected across various inpatient departments. Table IV shows the antibiotic-resistance pattern of MDR-GNB. It was noted that most of the Enterobacterales showed resistance to cefotaxime when the antimicrobial resistance pattern of the MDR-GNB was analyzed. Nevertheless, most of the

Distribution of multidrug-resistant Gram-negative bacilli isolated from different clinical specimens collected across various inpatient departments.
Antibiotic-resistance rate (in percentage) among multidrug-resistant Gram-negative bacilli.
Antibiotics | |||||||
---|---|---|---|---|---|---|---|
Amoxycillin/Clavulanic acid | 257 (53%) | 189 (71%) | 13 (87%) | ND | ND | ND | ND |
Piperacillin/tazobactam | 200 (42%) | 176 (66%) | 12 (80%) | 85 (54%) | 4 (67%) | 62 (89%) | – |
Cefotaxime | 455 (95%) | 251 (94%) | 14 (93%) | 24 (86 | ND* | 7 (88%) | 1 (100%) |
Ceftriaxone | 405 (84%) | 239 (90%) | 13 (87%) | 110 (70%) | 4 (67%) | 59 (84%) | – |
Cefepime | 93 (78%) | 198 (75%) | 14 (93%) | 115 (73%) | 4 (67%) | 65 (93%) | ND |
Imipenem | 399 (82%) | 223 (84%) | 11 (73%) | 104 (66%) | 5 (83%) | 68 (97%) | 1 (100%) |
Meropenem | 193 (40%) | 127 (48%) | 8 (53%) | 82 (52%) | 4 (67%) | 57 (81%) | 1 (100%) |
Gentamicin | 218 (45%) | 150 (7%) | 8 (53%) | 79 (50%) | 4 (67%) | 60 (86%) | 1 (100%) |
Amikacin | 79 (16%) | 85 (32%) | 8 (53%) | 72 (46%) | 4 (67%) | 36 (51%) | – |
Ciprofloxacin | 450 (94%) | 229 (86%) | 14 (93%) | 110 (70%) | 5 (83%) | 68 (97%) | 1 (100%) |
Cotrimoxazole | 257 (53%) | 175 (66%) | 09 (60%) | 143 (91%) | 05 (83%) | 59 (84%) | – |
ND – not done
Determination of colistin minimum inhibitory concentration (MICs) of different MDR Gram-negative isolates by Broth Micro Dilution method.
MICs of colistin (n = 995) | |||||
---|---|---|---|---|---|
≤ 0.5 μg/ml | 207 (74%) | 415 (86%) | 99 (61%) | 28 (40%) | – |
1 μg/ml | 17 (6%) | 23 (5%) | 36 (22%) | 30 (43%) | – |
2 μg/ml | 43 (16%) | 27 (6%) | 09 (6%) | 04 (6%) | – |
4 μg/ml | 09 (3%) | 06 (1%) | 17 (10%) | 06 (9%) | 01 (100%) |
8 μg/ml | 03 (1%) | 6 (1%) | 01 (0.61%) | 01 (1%) | – |
≥ 16 μg/ml | 01 (0.36%) | 04 (0.82%) | 01 (0.61%) | 01 (14%) | – |
Colistin has been considered the last resort for treating multidrug-resistant bacteria, but the emergence of colistin resistance in recent years has alarmed clinicians. Several risk factors have been investigated by researchers, including repeated antibiotic exposure (especially from beta-lactam antibiotics), invasive medical procedures, the excessive and improper application of colistin as a growth promoter in agriculture and animal husbandry, and the isolation of wastewater-borne bacteria resistant to colistin (Sharma et al. 2022; Yuan and Pian 2023). Therefore, it is essential to study the risk factors, co-morbidities, and antimicrobial susceptibility patterns of colistin-resistant bacteria to restrict the further spread of colistin resistance. The findings of our study highlight the significant influence of demographic variables on the prevalence of colistin-resistant GNB (Table II). The current study found an association between age, gender, education level, and colistin resistance. Specifically, the 41–60 age group showed notably higher colistin resistance rates among patients. This was consistent with earlier research, thereby highlighting the vulnerability of this particular age group to MDR bacterial infections (Mondal et al. 2024). The study also noted a gender gap, as males had a higher colistinresistant GNB prevalence than females. This aligns with findings from another study indicating a consistent gender-related correlation with colistin resistance across multiple studies (Panigrahi et al. 2022). Further, the study found a clear urban-rural divide in colistin resistance, with urban areas showing higher prevalence than rural areas. This would probably be due to the increased availability and over-usage of antibiotics in urban areas. Additionally, we observed a notable association between education level and colistin resistance, with patients with up to intermediate-level education exhibiting a higher proportion of colistin-resistant GNB than those with higher education levels. This finding underscores the complex interplay between the level of education and antimicrobial resistance; more specifically, patients with higher education are aware of the development of antimicrobial resistance and its serious complications. Moreover, the current study identified prolonged hospital stays (> 5 days) as a significant risk factor for colistin-resistant GNB. Diabetic patients showed the highest incidence, followed by those with chronic obstructive pulmonary disease and chronic renal disease. These findings highlight the importance of considering specific patient populations and clinical contexts in combating the spread of colistin resistance.
Out of 12,652 clinical samples examined, 3,061 (24%) showed growth of pathogenic bacteria. Of these pathogens, 27% (n = 824) were found to be Gram-positive bacteria, while 73% (n = 2,237) were found to be Gram-negative bacteria, respectively. This finding followed earlier research wherein the investigators found that Gram-negative bacteria accounted for a significant portion of the infections and were often resistant to multiple antibiotics (Chakraborty et al. 2023). In the current investigation, 2,237 Gram-negative bacteria were identified from all specimens processed. Among these, 44% were MDR-GNB, and 56% were non-MDR-GNB. This finding validates a previous report from Egyptian patients, indicating a consistent geographical distribution globally (El-Kholy et al. 2021). However, a study conducted among cancer patients in the Eastern part of India reported the distribution of MDR (48%), extensive drug resistance (30%), and non-MDR-GNB (20%), respectively (Shelke et al. 2024), aligning with our findings and highlighting a consistent pattern of antimicrobial resistance across Indian geographies.
The results of the current study demonstrate that
Of the total MDR-GNB (n = 995) isolated in the current study, 71% were isolated from the inpatient department. MICU had the most isolations, followed by emergency, urology, and respiratory departments, ICCU, and SICU. On the other hand, a study conducted in a tertiary care teaching hospital in central India revealed most of the GNBs isolated from different medical and surgical wards (57%), followed by ICU (26%) and OPDs (17%), respectively (Soni et al. 2023). This difference in the prevalence of distribution of MDR GNB may be attributed to the difference in the geographical locations. However, we could not compare studies conducted in North Indian settings because of the scarcity of literature. Various studies have consistently reported the isolation of colistin-resistant bacteria from different hospital settings. These studies have also highlighted variations observed across different departments and sample types (Sinha et al. 2019; Panigrahi et al. 2022; Soni et al. 2023). In the current study, the most colistin-resistant bacteria were isolated from pus samples (21%), followed by blood, sputum, urine, and a wound swab, respectively (Table III). Consistent with our findings, another research group also observed a high prevalence of MDR-GNB in a study conducted in central India (Soni et al. 2023). Nonetheless, other studies conducted in two distinct locations in India have demonstrated a higher isolation rate of colistinresistant bacteria from blood, exudates, and urine, as well as from sputum and pus samples, respectively (Sinha et al. 2019; Panigrahi et al. 2022).
Antibiotic resistance patterns differ from one bacterial species to another, from genus to genus, and also among different families. It is evident from Table IV that most Enterobacterales were resistant to cefotaxime whereas most of the
In contrast, the lowest resistance was found against imipenem (particularly isolates obtained from blood samples) (Shah et al. 2022). In contrast, substantial levels of resistance to ciprofloxacin and cefotaxime were noted against
Knowledge of the MIC values for colistin against MDR-GNB is essential for optimizing treatment strategies against these bacterial pathogens. In the current study, 6% (n = 57) of colistin-resistant MDR GNB were isolated from the total MDR-GNB (n = 995). However, none of the isolates harbored the
The sensitivity pattern of colistin-resistant Gramnegative bacteria to various antibiotics is critical in combating bacterial infections. The current study presents a comprehensive overview of antibiotic sensitivity across different bacterial strains, highlighting both promising and challenging aspects of treatment. When analyzing the susceptibility pattern of colistin-resistant
Antibiotic sensitivity pattern of colistin-resistant bacteria (n = 57).
Antibiotics | |||||
---|---|---|---|---|---|
Amoxicillin/clavulanic acid | 7 (44%) | 1 (8%) | ND | ND | – |
Piperacillin/tazobactam | 5 (31%) | – | 6 (32%) | 1 (17%) | 1 (100%) |
Cefotaxime | 1 (6%) | – | – | ND | – |
Ceftriaxone | 2 (13%) | – | 3 (16%) | – | 1 (100%) |
Cefepime | 2 (13%) | – | 1 (5%) | – | ND |
Imipenem | – | – | – | – | – |
Meropenem | 3 (9%) | – | 2 (11%) | 4 (50%) | – |
Gentamicin | 8 (50%) | 5 (38%) | 7 (37%) | 2 (33%) | – |
Amikacin | 13 (81%) | 5 (38%) | 10 (53%) | 6 (86%) | 1 (100%) |
Ciprofloxacin | 3 (19%) | 1 (8%) | 2 (11%) | 1 (14%) | – |
Cotrimoxazole | 10 (63%) | 4 (30%) | 0 | 1 (13%) | – |