Dynamics of Antimicrobial Susceptibility and Risk Factors Associated with Infections Caused by Colistin-Resistant Bacteria: A Study from the Northern Region of Haryana, India
26. März 2025
Über diesen Artikel
Artikel-Kategorie: ORIGINAL PAPER
Online veröffentlicht: 26. März 2025
Seitenbereich: 95 - 105
Eingereicht: 19. Aug. 2024
Akzeptiert: 05. Feb. 2025
DOI: https://doi.org/10.33073/pjm-2025-008
Schlüsselwörter
© 2025 Shubham Chauhan et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Fig. 4.

Antibiotic sensitivity pattern of colistin-resistant bacteria (n = 57)_
Antibiotics | |||||
---|---|---|---|---|---|
Amoxicillin/clavulanic acid | 7 (44%) | 1 (8%) | ND | ND | – |
Piperacillin/tazobactam | 5 (31%) | – | 6 (32%) | 1 (17%) | 1 (100%) |
Cefotaxime | 1 (6%) | – | – | ND | – |
Ceftriaxone | 2 (13%) | – | 3 (16%) | – | 1 (100%) |
Cefepime | 2 (13%) | – | 1 (5%) | – | ND |
Imipenem | – | – | – | – | – |
Meropenem | 3 (9%) | – | 2 (11%) | 4 (50%) | – |
Gentamicin | 8 (50%) | 5 (38%) | 7 (37%) | 2 (33%) | – |
Amikacin | 13 (81%) | 5 (38%) | 10 (53%) | 6 (86%) | 1 (100%) |
Ciprofloxacin | 3 (19%) | 1 (8%) | 2 (11%) | 1 (14%) | – |
Cotrimoxazole | 10 (63%) | 4 (30%) | 0 | 1 (13%) | – |
The primers used for the targeted gene_
Sr. No. | Amplicon size (bp) | Primer sequences (5’–3’) |
|
---|---|---|---|
1. | 320 | F: AGTCCGTTTGTTCTTGTGGC |
|
2. | 700 | F: CAAGTGTGTTGGTCGCAGTT |
|
3. | 900 | F: AAATAAAAATTGTTCCGCTTATG |
|
4. | 1,100 | F: TCACTTTCATCACTGCGTTG |
|
5. | 1,644 | F: ATGCGGTTGTCTGCATTTATC |
Antibiotic-resistance rate (in percentage) among multidrug-resistant Gram-negative bacilli_
Antibiotics | |||||||
---|---|---|---|---|---|---|---|
Amoxycillin/Clavulanic acid | 257 (53%) | 189 (71%) | 13 (87%) | ND | ND | ND | ND |
Piperacillin/tazobactam | 200 (42%) | 176 (66%) | 12 (80%) | 85 (54%) | 4 (67%) | 62 (89%) | – |
Cefotaxime | 455 (95%) | 251 (94%) | 14 (93%) | 24 (86 | ND* | 7 (88%) | 1 (100%) |
Ceftriaxone | 405 (84%) | 239 (90%) | 13 (87%) | 110 (70%) | 4 (67%) | 59 (84%) | – |
Cefepime | 93 (78%) | 198 (75%) | 14 (93%) | 115 (73%) | 4 (67%) | 65 (93%) | ND |
Imipenem | 399 (82%) | 223 (84%) | 11 (73%) | 104 (66%) | 5 (83%) | 68 (97%) | 1 (100%) |
Meropenem | 193 (40%) | 127 (48%) | 8 (53%) | 82 (52%) | 4 (67%) | 57 (81%) | 1 (100%) |
Gentamicin | 218 (45%) | 150 (7%) | 8 (53%) | 79 (50%) | 4 (67%) | 60 (86%) | 1 (100%) |
Amikacin | 79 (16%) | 85 (32%) | 8 (53%) | 72 (46%) | 4 (67%) | 36 (51%) | – |
Ciprofloxacin | 450 (94%) | 229 (86%) | 14 (93%) | 110 (70%) | 5 (83%) | 68 (97%) | 1 (100%) |
Cotrimoxazole | 257 (53%) | 175 (66%) | 09 (60%) | 143 (91%) | 05 (83%) | 59 (84%) | – |
Determination of colistin minimum inhibitory concentration (MICs) of different MDR Gram-negative isolates by Broth Micro Dilution method_
MICs of colistin (n = 995) | |||||
---|---|---|---|---|---|
≤ 0.5 μg/ml | 207 (74%) | 415 (86%) | 99 (61%) | 28 (40%) | – |
1 μg/ml | 17 (6%) | 23 (5%) | 36 (22%) | 30 (43%) | – |
2 μg/ml | 43 (16%) | 27 (6%) | 09 (6%) | 04 (6%) | – |
4 μg/ml | 09 (3%) | 06 (1%) | 17 (10%) | 06 (9%) | 01 (100%) |
8 μg/ml | 03 (1%) | 6 (1%) | 01 (0.61%) | 01 (1%) | – |
≥ 16 μg/ml | 01 (0.36%) | 04 (0.82%) | 01 (0.61%) | 01 (14%) | – |
Demographic characteristics and risk factors associated with colistin-resistant Gram-negative bacteria_
Demographic characteristics | MDR-GNB (n = 995) (%) | Colistin resistance (n = 57) (%) | Level of significance (Chi-square test) | |
---|---|---|---|---|
Age (years) | 0–20 years | 64 (6%) | 08 (13%) | 0.0816 |
21–40 years | 279 (28%) | 15 (5%) | ||
41–60 years | 361 (36%) | 23 (6%) | ||
Above 60 years | 291 (29%) | 11 (4%) | ||
Gender | Male | 602 (61%) | 46 (8%) | 0.2439 |
Female | 393 (39%) | 11 (3%) | ||
Residence | Rural | 724 (73%) | 40 (6%) | 0.6699 |
Urban | 271 (27%) | 17 (6%) | ||
Education | aIntermediate level | 530 (55%) | 47 (9%) | < 0.0001 |
bUndergraduate level | 357 (37%) | 06 (2%) | ||
cGraduate level or higher | 108 (6%) | 01 (2%) | ||
Risk factors associated with colistin resistance | ||||
Duration of hospital stay | Less than 48 h | 19(2%) | – | < 0.001 |
2–5 days | 99 (10%) | – | ||
5–15 days | 368 (37%) | 1 (2%) | ||
> 15 days | 509 (51%) | 56 (98%) | ||
History of previous hospitalization for more than 5 days with beta-lactam antibiotics | 448 (45%) | 41 (72%) | 0.0264 |
|
Diabetes | 278 (28%) | 32 (56%) | 0.0021 |
|
Chronic heart disease (CHD) | 139 (14%) | 1 (2%) | 0.0151 |
|
Chronic obstructive pulmonary disease (COPD) | 265 (27%) | 11 (19 %) | 0.0061 |
|
Chronic renal disease (CRD) | 129 (13%) | 4 (7%) | 0.2358 |
Distribution of multidrug resistance and colistin-resistant Gram-negative bacilli in various samples_
Specimens | Gram-negative isolates (n = 2,237) (%) | Colistin resistant bacteria (n = 57) (%) | |
---|---|---|---|
Blood | 402 (18%) | 112 (28%) | 9 (8%) |
Sputum | 419 (19%) | 151 (36%) | 9 (6%) |
Urine | 811 (34%) | 560 (69%) | 25 (4%) |
Wound swab | 165 (10% | 32 (19%) | 2 (6%) |
Pus | 322 (14%) | 137 (43%) | 12 (9%) |
Endotracheal swab | 46 (2%) | 02 (4%) | – |
Vaginal Swab | 72 (3%) | 01 (1%) | – |