1. bookVolume 72 (2021): Issue 3 (September 2021)
Journal Details
License
Format
Journal
First Published
26 Mar 2007
Publication timeframe
4 times per year
Languages
English
access type Open Access

Epigenetic toxicity and cytotoxicity of perfluorooctanoic acid and its effects on gene expression in embryonic mouse hypothalamus cells

Published Online: 28 Sep 2021
Page range: 182 - 190
Received: 01 May 2021
Accepted: 01 Sep 2021
Journal Details
License
Format
Journal
First Published
26 Mar 2007
Publication timeframe
4 times per year
Languages
English

Perfluorooctanoic acid (PFOA) is a synthetic surfactant used in various industrial and consumer water- and oil-resistant products with the annual production of several hundred metric tonnes since the 1950s, which makes it one of the most abundantly produced endocrine-disrupting chemicals (EDCs) worldwide (1). Its strong carbon-fluorine bond renders it highly stable and prone to bioaccumulation in the environment (2). It can easily be found in water, food, house dust, stain-resistant carpets, cookware coatings, and industrial waste (3, 4, 5, 6). This indicates a high risk of exposure, which has been confirmed by its discovery in human blood, breast milk, and umbilical cord serum (7, 8, 9, 10, 11). In addition, with its average half-life in humans of 2.4 years (12), PFOA has a potential of high bioaccumulation.

Exposure to EDCs such as PFOA during early development can have lifelong detrimental effects on metabolic homeostasis and endocrine physiology (13, 14). However, while studies demonstrate that development of the embryonic hypothalamus can be disrupted by PFOA, the underlying molecular mechanisms for the metabolic toxicity of PFOA are not yet clear. These involve epigenetic covalent modifications of histone tails (15, 16), small non-coding RNAs that regulate gene expression (17), and DNA methylation (18, 19, 20). Modifications in DNA methylation patterns lead to developmental reprogramming, and these epigenetic changes can be inherited through cell division (21). In addition, transgenerational exposure to EDCs can affect embryonic cell development through genomic imprinting (22). Previous research has shown that PFOA exposure induces changes in global DNA methylation in human umbilical cord serum (23), mouse embryonic fibroblasts (24), and human hepatocellular carcinoma cells (25), but there have been no studies on the effects of PFOA on global DNA methylation in mouse embryonic hypothalamus cells.

To fill this gap, our study focused on epigenetic toxicity and cytotoxicity of PFOA in mHypoE-N46 cells and its effects on gene expression and how it affects apoptosis, cell cycle, proliferation, and neurotrophic genes. In addition, it looked into its effects on gene modifications of ten-eleven translocation methylcytosine dioxygenases (Tets), DNA methyltransferases (Dnmts) and methyl-CpG binding protein 2 (Mecp2s).

Materials and methods
Cell culture and reagents

The mHypoE-N46 (Cellutions Biosystems, Burlington, Canada) cell line, derived from the mouse embryonic hypothalamus was immortalised by retroviral transfer of SV40 T-antigen into embryonic mouse hypothalamic primary cell cultures (days 15, 17, and 18) (26). The cells were cultured as a monolayer in Dulbecco’s modified Eagle medium (DMEM) with 25 mmol/L glucose (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 2 % foetal bovine serum (FBS, Gibco, Carlsbad, CA, USA) and 1 % penicillin/ streptomycin (Welgene, Daegu, Korea). The cells were incubated at 37 °C in 5 % CO2.

PFOA (Sigma-Aldrich) at final concentrations with a 10-fold difference from 0.25 to 250 μmol/L was dissolved in dimethyl sulphoxide (final concentration 0.1 %; Sigma-Aldrich). Dimethyl sulphoxide (0.1 %) was not toxic to the mHypoE-N46 cells and had no effect on cell survival or ability to divide (data not shown). To eliminate the effects of steroids contained in DMEM and FBS, PFOA treatment was performed in phenol red-free DMEM with 25 mmol/L glucose (Gibco), supplemented with 1 % charcoal-stripped FBS and 1 % penicillin/streptomycin.

Assessment of cell viability

The cells were seeded at 5x103 cells per well in 96-well plates with 200 μL of fresh complete medium and incubated at 37 °C in 5 % CO2 for 24 h. Cell culture medium (200 μL) was then replaced, and PFOA (at final concentrations of 0, 0.25, 2.5, 25, and 250 μmol/L) was added and incubated for 24 or 48 h. The CellTiter 96® non-radioactive cell proliferation assay kit (Promega, Madison, WI, USA) was used according to the manufacturer’s protocol. The absorbance was read at 570 nm using an enzyme-linked immunosorbent assay (ELISA) microplate reader (Molecular Devices, San Jose, CA, USA). The measured optical density values were normalised and cell viability analysed with the GraphPad Prism Software 7.0 (GraphPad Software, San Diego, CA, USA).

RNA isolation and quantitative real-time PCR

Neurons were harvested and total RNA extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA purity and concentration were quantified with the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed using the iTaqTM Universal SYBR® Green One-Step kit (Bio-Rad, Foster, CA, USA) with gene-specific primers (Table 1). Data were analysed using the 2-ΔΔCT method and transcript levels were normalised to those of the standardisation gene (β-actin).

List of primer sequences for quantitative real-time polymerase chain reaction

Gene Primer sequence (5′→3′) Amplicon size
Bax Forward: TGCAGAGGATGATTGCTGAC 173 bp
Reverse: GATCAGCTCGGGCACTTTAG
Casp3 Forward: CTGCCGGAGTCTGACTGGAA 97 bp
Reverse: ATCAGTCCCACTGTCTGTCTCAATG
Trp73 (p73) Forward: AGCCTTTGGTTGACTCCTATCG 119 bp
Reverse: ACCACCGTGTACCTTGTTCA
Ccna2 Forward: ACCTGCCTTCACTCATTGCT 139 bp
Reverse: TGGTGAAGGTCCACAAGACA
Ccnb1 Forward: CAGTTGTGTGCCCAAGAAGA 216 bp
Reverse: CTACGGAGGAAGTGCAGAGG
Ccne1 Forward: CACCACTGAGTGCTCCAGAA 230 bp
Reverse: CTGTTGGCTGACAGTGGAGA
Cdkn1a Forward: GGGATGGCAGTTAGGACTCA 244 bp
Reverse: GTGGGGCAAGTGCCTAGATA
Cdk4 Forward: CAATGTTGTACGGCTGATGG 178 bp
Reverse: CAGGCCGCTTAGAAACTGAC
Rps6 Forward: GTCCGCCAGTATGTTGTCAG 103 bp
Reverse: GTTGCAGGACACGAGGAGTA
Kitl Forward: TCATGGTGCACCGTATCCTA 170 bp
Reverse: CCTTGGCATGTTCTTCCACT
Bdnf Forward: GGTATCCAAAGGCCAACTGA 183 bp
Reverse: CTTATGAATCGCCAGCCAAT
Ntrk2 (TrkB) Forward: CGCCCTGTGAGCTGAACTCTG 171 bp
Reverse: CTGCTTCTCAGCTGCCTGACC
Ntrk1 (TrkA) Forward: GAGGTCTCTGTCCAAGTCAGCG 131 bp
Reverse: TTGAACAACCAGCGCAGAGA
Ngf Forward: CAGACCCGCAACATCACTGTA 131 bp
Reverse: CCATGGGCCTGGAAGTCTAG
Tet1 Forward: CGAAAGAACAGCCACCAGAT 219 bp
Reverse: TTGCTCTTCTTCCCCATGAC
Tet2 Forward: GTTGCAAGAAGAAAGCGGAG 229 bp
Reverse: CTCTGCCCTTGCTGAAGGT
Tet3 Forward: TCCGGATTGAGAAGGTCATC 176 bp
Reverse: CCAGGCCAGGATCAAGATAA
Dnmt1 Forward: CCTAGTTCCGTGGCTACGAGGAGAA 136 bp
Reverse: TCTCTCTCCTCTGCAGCCGACTCA
Dnmt3a Forward: CACAGGGCCCGTTACTTCTG 76 bp
Reverse: TCCAGCTTATCATTCACAGTGGAT
Dnmt3b Forward: TTCAGTGACCAGTCCTCAGACACGAA 144 bp
Reverse: TCAGAAGGCTGGAGACCTCCCTCTT
Mecp2_e1 Forward: AGGAGAGACTGGAGGAAAAGT 70 bp
Reverse: CTTAAACTTCAGTGGCTTGTCT
Mecp2_e2 Forward: CTCCATAAAAATACAGACTCACCAGT 183 bp
Reverse: CTTAAACTTCAGTGGCTTGTCT
β-actin Forward: ATGGTGGGAATGGGTCAGAAG 157 bp
Reverse: CACGCAGCTCATTGTAGAAGG
Global DNA methylation assay

Genomic DNA from mHypoE-N46 was extracted immediately after PFOA treatment using the G-spinTM Total DNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea). Total DNA quantity and quality were tested with the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). The whole-genome DNA methylation profile was determined using the EpiGentek MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, Farmingdale, NY, USA) following the manufacturer’s protocols.

Statistical analysis

Results are presented as mean ± SEM (standard error of the mean) and analysed with the GraphPad Prism Software 7.0. Statistical significance at p<0.05 was determined with one-way ANOVA, followed by a Bonferroni post hoc test. For the calculation of the half maximal inhibitory concentration (IC50), we relied on the Quest Graph™ IC50 Calculator program from the AAT Bioquest website (27).

Results
Cell viability

The MTT analysis showed a drop in cell viability in a dose-dependent manner in both 24 and 48-hour PFOA treatment (Figure 1). No statistically significant differences were found between the PFOA concentrations of 0.25 μmol/L and 2.5 μmol/L, but they started to show with 25 μmol/L (p<0.01) and 250 μmol/L (p<0.001). As 48-hour PFOA treatment showed little difference from the 24-hour treatment, all subsequent experiments were done in cells cultured with PFOA for 24 h. IC50 for 24-hour exposure to PFOA was 27.5 μmol/L. Gene expression experiments were therefore performed on cells treated with 2.5 μmol/L and 25 μmol/L of PFOA, whose viability was higher than the IC50.

Figure 1

Cell viability of mHypoE-N46 cells following PFOA treatment for (A) 24 h and (B) 48 h (MTT assay). Data are shown as mean ± standard error of triplicate measurements. ** p<0.01 and *** p<0.001 compared to control

Effect of PFOA on apoptosis-, cell cycle-, and proliferation-related genes

Because of the previously reported effects of PFOA on cell cycle and proliferation (25, 28, 29, 30) and the strong effect on cell viability found in this study, we decided to continue by testing several genes related to apoptosis, cell cycle, and proliferation.

Figure 2A shows the expression levels of the apoptotic genes Bax, Casp3, and Trp73. The expression of the Bax gene, which acts as a pro-apoptotic regulator, increased significantly (p<0.001) upon PFOA exposure in a dose-dependent manner, while the Casp3 gene expression in apoptotic cells significantly decreased at 2.5 μmol/L (p<0.01) and 25 μmol/L (p<0.05). The mRNA level of the Trp73 gene, which encodes for the p73 protein involved in cell-cycle regulation and induction of apoptosis, significantly decreased after exposure to 2.5 μmol/L (p<0.05) and 25 μmol/L (p<0.01) of PFOA.

Figure 2

Expression of (A) apoptosis-related genes, (B) cell cycle-related genes, and (C) cell proliferation-related genes after 24 h of exposure to PFOA (qPCR). Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control

Figure 2B shows the expression patterns of three cell cycle-related genes, Ccna2, Ccnb1, and Ccne1. PFOA had no significant effect on Ccna2, but the expression of Ccnb1, which encodes for G2/mitotic-specific cyclin-B1, increased significantly in dose-dependent manner upon exposure to both 2.5 μmol/L (p<0.01) and 25 μmol/L (p<0.001) of PFOA. Ccne1 gene expression, on the other hand, was downregulated at both PFOA concentrations (p<0.01).

Figure 2C shows the expression levels of Cdkn1a, Cdk4, Rps6, and Kit1, which are genes related to cell proliferation. The expression of the cyclin-dependent kinase (CDK) inhibitor 1-encoding Cdkn1a significantly increased in a dose-dependent manner (p<0.05 at 2.5 μmol/L and p<0.001 at 25 μmol/L), but other proliferation gene expressions were not significantly affected.

Effect of PFOA on nerve growth factor-related genes

In the nerve growth factor – neurotrophic tyrosine kinase receptor type 1 (NGF-NTRK1) neurotrophin system, the gene expression level of the ligand Ngf significantly increased (p<0.05) with exposure to 25 μmol/L of PFOA, unlike the gene expression of receptor Ntrk1 (Figure 3A).

Figure 3

Expression of (A) ligand (Ngf) and receptor (Ntrk1) genes of the NGF-NTRK1 neurotrophin system and (B) ligand (Bdnf) and receptor (Ntrk2) genes of the BDNF-NTRK2 neurotrophin system after 24 h of exposure to PFOA (PCR). Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control

In the BDNF-NTRK2 neurotrophin system, 25 μmol/L of PFOA significantly (p<0.01) increased the expression of the ligand Bdnf gene, while both concentrations significantly increased the expression of Ntrk2, a high-affinity catalytic receptor for several neurotrophins and BDNF (p<0.001) (Figure 3B).

Epigenetic toxicity of PFOA

As PFOA showed dose-dependent effects on some genes, we decided to assess global DNA methylation to better understand its effect on genome-wide gene expression. Genome-wide 5-methylcytosine content showed a significant dose-dependent increase compared to control at both PFOA concentrations (p<0.01 at 2.5 μmol/L and p<0.001 at 25 μmol/L) (Figure 4A).

Figure 4

Epigenetic toxicity of PFOA: (A) relative global methylation levels; (B) relative expression of ten-eleven translocation methylcytosine dioxygenase-encoding Tet1, Tet2, and Tet3; (C) relative expression of DNA methyltransferase-encoding Dnmt1, Dnmt3a, and Dnmt3b, and (D) relative expression of methyl-CpG binding protein 2 genes. Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control

To better understand the mechanism of how methylation levels change, we also analysed relative gene expression of Tet1, Tet2, Tet3, Dnmt1, Dnmt3a, and Dnmt3b. Tet1 and Tet3 increased significantly with both PFOA concentrations (p<0.001), whereas the mRNA expression of Tet2 significantly decreased at PFOA concentration of 2.5 μmol/L (p<0.05) (Figure 4B). The expression of Dnmt1 (p<0.05), Dnmt3a, and Dnmt3b (p<0.001) significantly decreased at 25 μmol/L of PFOA, while the Dnmt3b gene expression also significantly decreased at 2.5 μmol/L (p<0.01) (Figure 4C). Finally, in order to investigate the effect of PFOA on CpG-DNA-mediated gene transcription and the involvement of methyl-CpG binding protein, we analysed the changes in gene expression of Mecp2 isoforms e1 and e2, which are important readers of DNA methylation. The expression of both isoforms, significantly decreased at 2.5 μmol/L (p<0.01 and p<0.05, respectively; Figure 4D).

Discussion

To determine the effects of PFOA on embryonic hypothalamic cell metabolism, this study evaluated the expression of apoptosis, cell cycle, and cell proliferation genes that play an important role in the development and survival of early neurons. Our results confirmed earlier reports of PFOA cytotoxicity, epigenetic toxicity, and its effects on gene expression and pointed to the mechanisms behind them. The most prominent outcomes of PFOA treatment on mHypoE-N46 cells were a dose dependent drop in cell viability, changes in the expression of some genes related to cell cycle, proliferation, and NGFs, and the activation of apoptosis-related genes. There was a dose-dependent increase in global DNA methylation, and a change in the expression of the Tet and Dnmt genes. The expression of the Mecp2s gene, an important reader of DNA methylation, was reduced.

One of the most important findings of this study is the low PFOA IC50 value (27.52 μmol/L), which clearly suggests that embryonic hypothalamic cells are more sensitive to PFOA toxicity than other tissue cells. In previous studies (24, 25, 31, 32), the PFOA IC50 in other cell types was mostly above 200 μmol/L.

Among different genes involved in the neuronal apoptosis mechanism, here we focused on Bax, Casp3 and Trp73 genes. Bax acts as a pro-apoptotic regulator (33). Inactivation of Casp3 causes a delay in neuronal apoptosis (34), while activation of Trp73 has been implicated in apoptosis induced by abnormal cell proliferation and DNA damage (35, 36). We found that exposure to PFOA significantly increased the Bax gene expression in embryonic hypothalamus cells in a dose-dependent manner, while the expression of Casp3 and Trp73 genes significantly decreased. This decrease in the expression of Casp3 and Trp73 was consistent with the reports for bisphenol A, another EDC that interferes with developmental processes in the foetal brain (37). Our results confirmed Casp3 and Trp73-mediated mechanism of PFOA inhibiting apoptosis in embryonic hypothalamus cells, which was consistent with BPA. However, the finding that PFOA led to a dose-dependent increase in the Bax gene expression, suggests that Bax-mediated mechanism of apoptosis prevails, despite the delay and suppression mechanisms mediated by Casp3 and Trp73.

We were also interested in how PFOA affects the cell cycle. We already know that CCNA2 regulates cell cycle progression by interacting with CDK during both the G1/S and G2/M transition phases (38). CCNB1 and CCNE1 are essential for the G2/M and G1/S transition, respectively (39, 40). Previous studies have shown that exposure to PFOA alters the expression of cyclin-related genes in the human hepatoma cell line (HepG2) and human primary hepatocytes cells (41). With PFOA exposure, such a change in cyclin encoding gene may point to the disturbance in the cell cycle. CDKN1A regulates cell proliferation indirectly at the transcriptional level (42, 43, 44) or directly through proliferating cell nuclear antigen (45) and binding to CDKs (46, 47). Our results showed that the expression of Cdkn1a significantly increased in all PFOA-treated groups. Overexpression of p21/CDKN1A can inhibit cell proliferation (48) and may be involved in apoptosis (49, 50). Overall, since there was no clear association between PFOA exposure and decreased cell viability, it is likely that the change in the expression of the cell homeostasis gene impaired cell viability.

Our study also focused on the neurotrophins, which are important for the survival, development, and function of neurons (51, 52), while in embryonic neurons they can regulate apoptosis (53, 54). We analysed relative changes in the expression of Ngf, Ntrk1, Bdnf, and Ntrk2 and found that PFOA exposure affected the BDNF-NTRK2 neurotrophin system, as the expression levels of both the ligand Bdnf and the receptor Ntrk2 gene significantly increased. In related studies (37, 55), exposure to BPA altered the expression of Ngf and Bdnf genes, but not of Ntrk1 and Ntrk2. This suggests that changes in ligands of both neurotrophin systems caused by PFOA may follow a mechanism similar to that of BPA. On the other hand, the change in the expression of Ntrk2 suggests that PFOA disrupts the neurotrophin system through a specific mechanism, different from that of BPA. Additionally, these neurotrophin systems can interact with each other to regulate cell survival and death (53). We, therefore, believe that changes in the neurotrophin system caused by PFOA may affect not only growth and development but also survival of embryonic hypothalamic cells.

Our findings have also confirmed that PFOA increases overall DNA methylation in embryonic hypothalamic cells in a dose-dependent manner, unlike previous studies showing reduced global DNA methylation in PFOA-treated HepG2 and human breast epithelial cells (MCF7) (25, 31). This can be explained by the reported differences in the patterns of gene expression and epigenetic changes between tissues and cells (56, 57).

To evaluate the initiators of the changes in the patterns of DNA methylation after PFOA treatment we focused on Tets (mouse homologue of human TETs) and Dnmts (mouse homologue of human DNMTs). Dnmts and Tet2 expression decreased, while Tet1 and Tet3 expression and global DNA methylation increased. This points to a correlation between the level of PFOA exposure and the expression of cell homeostasis and nerve growth factor genes, and suggests that PFOA-induced epigenetic changes may play an important role in altering cell homeostasis and expression of neuronal growth factor genes.

Our findings of significantly downregulated expression of Mecp2_e1 and Mecp2_e2 genes may have wide ramifications, as MeCP2 not only aids in transcriptional silencing and acts as long-range regulator of methylated genes (58) but it also affects the expression of thousands of genes in the hypothalamus (59).

Conclusion

Overall, our findings suggest that exposure to PFOA affects cell survival through the reprogramming of embryonic hypothalamic DNA methylation patterns and altering cell homeostasis genes. They also suggest that DNA methylation and Mecp2 gene expression changes induced by PFOA could alter genes of other major mechanisms of the embryonic hypothalamus. All this may serve as a good starting point for further research into the mechanisms of PFOA effects on hypothalamic development.

Figure 1

Cell viability of mHypoE-N46 cells following PFOA treatment for (A) 24 h and (B) 48 h (MTT assay). Data are shown as mean ± standard error of triplicate measurements. ** p<0.01 and *** p<0.001 compared to control
Cell viability of mHypoE-N46 cells following PFOA treatment for (A) 24 h and (B) 48 h (MTT assay). Data are shown as mean ± standard error of triplicate measurements. ** p<0.01 and *** p<0.001 compared to control

Figure 2

Expression of (A) apoptosis-related genes, (B) cell cycle-related genes, and (C) cell proliferation-related genes after 24 h of exposure to PFOA (qPCR). Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control
Expression of (A) apoptosis-related genes, (B) cell cycle-related genes, and (C) cell proliferation-related genes after 24 h of exposure to PFOA (qPCR). Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control

Figure 3

Expression of (A) ligand (Ngf) and receptor (Ntrk1) genes of the NGF-NTRK1 neurotrophin system and (B) ligand (Bdnf) and receptor (Ntrk2) genes of the BDNF-NTRK2 neurotrophin system after 24 h of exposure to PFOA (PCR). Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control
Expression of (A) ligand (Ngf) and receptor (Ntrk1) genes of the NGF-NTRK1 neurotrophin system and (B) ligand (Bdnf) and receptor (Ntrk2) genes of the BDNF-NTRK2 neurotrophin system after 24 h of exposure to PFOA (PCR). Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control

Figure 4

Epigenetic toxicity of PFOA: (A) relative global methylation levels; (B) relative expression of ten-eleven translocation methylcytosine dioxygenase-encoding Tet1, Tet2, and Tet3; (C) relative expression of DNA methyltransferase-encoding Dnmt1, Dnmt3a, and Dnmt3b, and (D) relative expression of methyl-CpG binding protein 2 genes. Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control
Epigenetic toxicity of PFOA: (A) relative global methylation levels; (B) relative expression of ten-eleven translocation methylcytosine dioxygenase-encoding Tet1, Tet2, and Tet3; (C) relative expression of DNA methyltransferase-encoding Dnmt1, Dnmt3a, and Dnmt3b, and (D) relative expression of methyl-CpG binding protein 2 genes. Data are shown as mean ± standard error of three independent measurements. * p<0.05, ** p<0.01, and *** p<0.001 compared to control

List of primer sequences for quantitative real-time polymerase chain reaction

Gene Primer sequence (5′→3′) Amplicon size
Bax Forward: TGCAGAGGATGATTGCTGAC 173 bp
Reverse: GATCAGCTCGGGCACTTTAG
Casp3 Forward: CTGCCGGAGTCTGACTGGAA 97 bp
Reverse: ATCAGTCCCACTGTCTGTCTCAATG
Trp73 (p73) Forward: AGCCTTTGGTTGACTCCTATCG 119 bp
Reverse: ACCACCGTGTACCTTGTTCA
Ccna2 Forward: ACCTGCCTTCACTCATTGCT 139 bp
Reverse: TGGTGAAGGTCCACAAGACA
Ccnb1 Forward: CAGTTGTGTGCCCAAGAAGA 216 bp
Reverse: CTACGGAGGAAGTGCAGAGG
Ccne1 Forward: CACCACTGAGTGCTCCAGAA 230 bp
Reverse: CTGTTGGCTGACAGTGGAGA
Cdkn1a Forward: GGGATGGCAGTTAGGACTCA 244 bp
Reverse: GTGGGGCAAGTGCCTAGATA
Cdk4 Forward: CAATGTTGTACGGCTGATGG 178 bp
Reverse: CAGGCCGCTTAGAAACTGAC
Rps6 Forward: GTCCGCCAGTATGTTGTCAG 103 bp
Reverse: GTTGCAGGACACGAGGAGTA
Kitl Forward: TCATGGTGCACCGTATCCTA 170 bp
Reverse: CCTTGGCATGTTCTTCCACT
Bdnf Forward: GGTATCCAAAGGCCAACTGA 183 bp
Reverse: CTTATGAATCGCCAGCCAAT
Ntrk2 (TrkB) Forward: CGCCCTGTGAGCTGAACTCTG 171 bp
Reverse: CTGCTTCTCAGCTGCCTGACC
Ntrk1 (TrkA) Forward: GAGGTCTCTGTCCAAGTCAGCG 131 bp
Reverse: TTGAACAACCAGCGCAGAGA
Ngf Forward: CAGACCCGCAACATCACTGTA 131 bp
Reverse: CCATGGGCCTGGAAGTCTAG
Tet1 Forward: CGAAAGAACAGCCACCAGAT 219 bp
Reverse: TTGCTCTTCTTCCCCATGAC
Tet2 Forward: GTTGCAAGAAGAAAGCGGAG 229 bp
Reverse: CTCTGCCCTTGCTGAAGGT
Tet3 Forward: TCCGGATTGAGAAGGTCATC 176 bp
Reverse: CCAGGCCAGGATCAAGATAA
Dnmt1 Forward: CCTAGTTCCGTGGCTACGAGGAGAA 136 bp
Reverse: TCTCTCTCCTCTGCAGCCGACTCA
Dnmt3a Forward: CACAGGGCCCGTTACTTCTG 76 bp
Reverse: TCCAGCTTATCATTCACAGTGGAT
Dnmt3b Forward: TTCAGTGACCAGTCCTCAGACACGAA 144 bp
Reverse: TCAGAAGGCTGGAGACCTCCCTCTT
Mecp2_e1 Forward: AGGAGAGACTGGAGGAAAAGT 70 bp
Reverse: CTTAAACTTCAGTGGCTTGTCT
Mecp2_e2 Forward: CTCCATAAAAATACAGACTCACCAGT 183 bp
Reverse: CTTAAACTTCAGTGGCTTGTCT
β-actin Forward: ATGGTGGGAATGGGTCAGAAG 157 bp
Reverse: CACGCAGCTCATTGTAGAAGG

Lindstrom AB, Strynar MJ, Libelo EL. Polyfluorinated compounds: Past, present, and future. Environ Sci Technol 2011;45:7954–61. doi: 10.1021/es2011622Lindstrom AB Strynar MJ Libelo EL Polyfluorinated compounds: Past, present, and future Environ Sci Technol 2011457954 61 10.1021/es2011622Open DOISearch in Google Scholar

Giesy JP, Kannan K. Perfluorochemical surfactants in the environment. Environ Sci Technol 2002;36:146A-52A. doi: 10.1021/es022253tGiesy JP Kannan K Perfluorochemical surfactants in the environment Environ Sci Technol 200236146A 52A 10.1021/es022253tOpen DOISearch in Google Scholar

Schecter A, Colacino J, Haffner D, Patel K, Opel M, Päpke O, Birnbaum L. Perfluorinated compounds, polychlorinated biphenyl, and organochlorine pesticide contamination in composite food samples from Dallas, Texas, USA. Environ Health Perspect 2010;118:796–802. doi: 10.1289/ehp.0901347Schecter A Colacino J Haffner D Patel K Opel M Päpke O Birnbaum L Perfluorinated compounds, polychlorinated biphenyl, and organochlorine pesticide contamination in composite food samples from Dallas, Texas, USA Environ Health Perspect 2010118796 802 10.1289/ehp.0901347Open DOISearch in Google Scholar

Langer V, Dreyer A, Ebinghaus R. Polyfluorinated compounds in residential and nonresidential indoor air. Environ Sci Technol 2010;44:8075–81. doi: 10.1021/es102384zLanger V Dreyer A Ebinghaus R Polyfluorinated compounds in residential and nonresidential indoor air Environ Sci Technol 2010448075 81 10.1021/es102384zOpen DOISearch in Google Scholar

D’Eon JC, Mabury SA. Is indirect exposure a significant contributor to the burden of perfluorinated acids observed in humans? Environ Sci Technol 2011;45:7974–84. doi: 10.1021/es200171yD’Eon JC Mabury SA Is indirect exposure a significant contributor to the burden of perfluorinated acids observed in humans? Environ Sci Technol 2011457974 84 10.1021/es200171yOpen DOISearch in Google Scholar

Nicole W. PFOA and cancer in a highly exposed community: New findings from the C8 science panel. Environ Health Perspect 2013;121:A340. doi: 10.1289/ehp.121-A340Nicole W PFOA and cancer in a highly exposed community: New findings from the C8 science panel Environ Health Perspect 2013121A340 10.1289/ehp.121-A340Open DOISearch in Google Scholar

Apelberg BJ, Witter FR, Herbstman JB, Calafat AM, Halden RU, Needham LL, Goldman LR. Cord serum concentrations of perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) in relation to weight and size at birth. Environ Health Perspect 2007;115:1670–6. doi: 10.1289/ehp.10334Apelberg BJ Witter FR Herbstman JB Calafat AM Halden RU Needham LL Goldman LR Cord serum concentrations of perfluorooctane sulfonate (PFOS) and perfluorooctanoate (PFOA) in relation to weight and size at birth Environ Health Perspect 20071151670 6 10.1289/ehp.10334Open DOISearch in Google Scholar

Tao L, Kannan K, Wong CM, Arcaro KF, Butenhoff JL. Perfluorinated compounds in human milk from Massachusetts, USA. Environ Sci Technol 2008;42:3096–101. doi: 10.1021/es702789kTao L Kannan K Wong CM Arcaro KF Butenhoff JL Perfluorinated compounds in human milk from Massachusetts, USA Environ Sci Technol 2008423096 101 10.1021/es702789kOpen DOISearch in Google Scholar

von Ehrenstein OS, Fenton SE, Kato K, Kuklenyik Z, Calafat AM, Hines EP. Polyfluoroalkyl chemicals in the serum and milk of breastfeeding women. Reprod Toxicol 2009;27:239–45. doi: 10.1016/j.reprotox.2009.03.001von Ehrenstein OS Fenton SE Kato K Kuklenyik Z Calafat AM Hines EP Polyfluoroalkyl chemicals in the serum and milk of breastfeeding women Reprod Toxicol 20092723945 10.1016/j.reprotox.2009.03.001Open DOISearch in Google Scholar

Llorca M, Farré M, Picó Y, Teijón ML, Alvarez JG, Barceló D. Infant exposure of perfluorinated compounds: levels in breast milk and commercial baby food. Environ Int 2010;36:584–92. doi: 10.1016/j.envint.2010.04.016Llorca M Farré M Picó Y Teijón ML Alvarez JG Barceló D Infant exposure of perfluorinated compounds: levels in breast milk and commercial baby food Environ Int 201036584 92 10.1016/j.envint.2010.04.016Open DOISearch in Google Scholar

Brantsæter AL, Whitworth KW, Ydersbond TA, Haug LS, Haugen M, Knutsen HK, Thomsen C, Meltzer HM, Becher G, Sabaredzovic A, Hoppin JA, Eggesbø M, Longnecker MP. Determinants of plasma concentrations of perfluoroalkyl substances in pregnant Norwegian women. Environ Int 2013;54:74–84. doi: 10.1016/j.envint.2012.12.014Brantsæter AL Whitworth KW Ydersbond TA Haug LS Haugen M Knutsen HK Thomsen C Meltzer HM Becher G Sabaredzovic A Hoppin JA Eggesbø M Longnecker MP Determinants of plasma concentrations of perfluoroalkyl substances in pregnant Norwegian women Environ Int 20135474 84 10.1016/j.envint.2012.12.014Open DOISearch in Google Scholar

Russell MH, Waterland RL, Wong F. Calculation of chemical elimination half-life from blood with an ongoing exposure source: The example of perfluorooctanoic acid (PFOA). Chemosphere 2015;129:210–6. doi: 10.1016/j.chemosphere.2014.07.061Russell MH Waterland RL Wong F Calculation of chemical elimination half-life from blood with an ongoing exposure source: The example of perfluorooctanoic acid (PFOA) Chemosphere 2015129210 6 10.1016/j.chemosphere.2014.07.061Open DOISearch in Google Scholar

Legler J, Hamers T, van E van der S de Bor M, Schoeters G, van der Ven L, Eggesbo M, Koppe J, Feinberg M, Trnovec T. The OBELIX project: early life exposure to endocrine disruptors and obesity. Am J Clin Nutr 2011;94:1933S–8S. doi: 10.3945/ajcn.110.001669 Legler J Hamers T van E van der S de Bor M Schoeters G van der Ven L Eggesbo M Koppe J Feinberg M Trnovec T The OBELIX project: early life exposure to endocrine disruptors and obesity Am J Clin Nutr 2011941933S 8 10.3945/ajcn.110.001669Open DOISearch in Google Scholar

Heindel JJ, Newbold R, Schug TT. Endocrine disruptors and obesity. Nat Rev Endocrinol 2015;11:653–61. doi: 10.1038/nrendo.2015.163Heindel JJ Newbold R Schug TT Endocrine disruptors and obesity Nat Rev Endocrinol 201511653 61 10.1038/nrendo.2015.163Open DOISearch in Google Scholar

Portela A, Esteller M. Epigenetic modifications and human disease. Nat Biotechnol 2010;28:1057–68. doi: 10.1038/nbt.1685Portela A Esteller M Epigenetic modifications and human disease Nat Biotechnol 2010281057 68 10.1038/nbt.1685Open DOISearch in Google Scholar

Bannister AJ, Kouzarides T. Regulation of chromatin by histone modifications. Cell Res 2011;21:381–95. doi: 10.1038/cr.2011.22Bannister AJ Kouzarides T Regulation of chromatin by histone modifications Cell Res 201121381 95 10.1038/cr.2011.22Open DOISearch in Google Scholar

Mattick JS, Makunin IV. Non-coding RNA. Hum Mol Genet 2006;15:R17–29. doi: 10.1093/hmg/ddl046Mattick JS Makunin IV Non-coding RNA Hum Mol Genet 200615R17 29 10.1093/hmg/ddl046Open DOISearch in Google Scholar

Razin A, Riggs AD. DNA methylation and gene function. Science 1980;210:604–10. doi: 10.1126/science.6254144Razin A Riggs AD DNA methylation and gene function Science 1980210604 10 10.1126/science.6254144Open DOISearch in Google Scholar

Robertson KD. DNA methylation and human disease. Nat Rev Genet 2005;6:597–610. doi: 10.1038/nrg1655Robertson KD DNA methylation and human disease Nat Rev Genet 20056597 610 10.1038/nrg1655Open DOISearch in Google Scholar

Kass SU, Pruss D, Wolffe AP. How does DNA methylation repress transcription? Trends Genet 1997;13:444–9. doi: 10.1016/S0168-9525(97)01268-7Kass SU Pruss D Wolffe AP How does DNA methylation repress transcription? Trends Genet 199713444 9 10.1016/S0168-9525(97)01268-7Open DOISearch in Google Scholar

Suvà ML, Riggi N, Bernstein BE. Epigenetic reprogramming in cancer. Science 2013;339:1567–70. doi: 10.1126/science.1230184Suvà ML Riggi N Bernstein BE Epigenetic reprogramming in cancer Science 20133391567 70 10.1126/science.1230184Open DOISearch in Google Scholar

Janesick AS, Shioda T, Blumberg B. Transgenerational inheritance of prenatal obesogen exposure. Mol Cell Endocrinol 2014;398:31–5. doi: 10.1016/j.mce.2014.09.002Janesick AS Shioda T Blumberg B Transgenerational inheritance of prenatal obesogen exposure Mol Cell Endocrinol 201439831 5 10.1016/j.mce.2014.09.002Open DOISearch in Google Scholar

Guerrero-Preston R, Goldman LR, Brebi-Mieville P, Ili-Gangas C, LeBron C, Witter FR, Apelberg BJ, Hernández-Roystacher M, Jaffe A, Halden RU, Sidransky D. Global DNA hypomethylation is associated with in utero exposure to cotinine and perfluorinated alkyl compounds. Epigenetics 2010;5:539–46. doi: 10.4161/epi.5.6.12378Guerrero-Preston R Goldman LR Brebi-Mieville P Ili-Gangas C LeBron C Witter FR Apelberg BJ Hernández-Roystacher M Jaffe A Halden RU Sidransky D Global DNA hypomethylation is associated with in utero exposure to cotinine and perfluorinated alkyl compounds Epigenetics 20105539 46 10.4161/epi.5.6.12378Open DOISearch in Google Scholar

Ma Y, Yang J, Wan Y, Peng Y, Ding S, Li Y, Xu B, Chen X, Xia W, Ke Y, Xu S. Low-level perfluorooctanoic acid enhances 3 T3-L1 preadipocyte differentiation via altering peroxisome proliferator activated receptor gamma expression and its promoter DNA methylation. J Anal Toxicol 2018;38:398–407. doi: 10.1002/jat.3549Ma Y Yang J Wan Y Peng Y Ding S Li Y Xu B Chen X Xia W Ke Y Xu S Low-level perfluorooctanoic acid enhances 3 T3-L1 preadipocyte differentiation via altering peroxisome proliferator activated receptor gamma expression and its promoter DNA methylation J Anal Toxicol 201838398 407 10.1002/jat.3549Open DOISearch in Google Scholar

Wen Y, Mirji N, Irudayaraj J. Epigenetic toxicity of PFOA and GenX in HepG2 cells and their role in lipid metabolism. Toxicology in Vitro 2020;65:104797. doi: 10.1016/j.tiv.2020.104797Wen Y Mirji N Irudayaraj J Epigenetic toxicity of PFOA and GenX in HepG2 cells and their role in lipid metabolism Toxicology in Vitro 202065104797 10.1016/j.tiv.2020.104797Open DOISearch in Google Scholar

Belsham DD, Cai F, Cui H, Smukler SR, Salapatek AM, Shkreta L. Generation of a phenotypic array of hypothalamic neuronal cell models to study complex neuroendocrine disorders. Endocrinology 2004;145:393–400. doi: 10.1210/en.2003-0946Belsham DD Cai F Cui H Smukler SR Salapatek AM Shkreta L Generation of a phenotypic array of hypothalamic neuronal cell models to study complex neuroendocrine disorders Endocrinology 2004145393 400 10.1210/en.2003-0946Open DOISearch in Google Scholar

AAT Bioquest. IC50 calculator, version 1 [displayed 25 june 2021]. Available at https://www.aatbio.com/tools/ic50-calculator-v1AAT Bioquest IC50 calculator, version 1 [displayed 25 june 2021] Available at https://www.aatbio.com/tools/ic50-calculator-v1Search in Google Scholar

Hagenaars A, Vergauwen L, Benoot D, Laukens K, Knapen D. Mechanistic toxicity study of perfluorooctanoic acid in zebrafish suggests mitochondrial dysfunction to play a key role in PFOA toxicity. Chemosphere 2013;91:844–56. doi: 10.1016/j.chemosphere.2013.01.056Hagenaars A Vergauwen L Benoot D Laukens K Knapen D Mechanistic toxicity study of perfluorooctanoic acid in zebrafish suggests mitochondrial dysfunction to play a key role in PFOA toxicity Chemosphere 201391844 56 10.1016/j.chemosphere.2013.01.056Open DOISearch in Google Scholar

Peng S, Yan L, Zhang J, Wang Z, Tian M, Shen H. An integrated metabonomics and transcriptomics approach to understanding metabolic pathway disturbance induced by perfluorooctanoic acid. J Pharm Biomed Anal 2013;86:56–64. doi: 10.1016/j.jpba.2013.07.014Peng S Yan L Zhang J Wang Z Tian M Shen H An integrated metabonomics and transcriptomics approach to understanding metabolic pathway disturbance induced by perfluorooctanoic acid J Pharm Biomed Anal 2013865664 10.1016/j.jpba.2013.07.014Open DOISearch in Google Scholar

Yan S, Zhang H, Zheng F, Sheng N, Guo X, Dai J. Perfluorooctanoic acid exposure for 28 days affects glucose homeostasis and induces insulin hypersensitivity in mice. Sci Rep 2015;5:11029. doi: 10.1038/srep11029Yan S Zhang H Zheng F Sheng N Guo X Dai J Perfluorooctanoic acid exposure for 28 days affects glucose homeostasis and induces insulin hypersensitivity in mice Sci Rep 2015511029 10.1038/srep11029Open DOISearch in Google Scholar

Liu W, Irudayaraj J. Perfluorooctanoic acid (PFOA) exposure inhibits DNA methyltransferase activities and alters constitutive heterochromatin organization. Food Chem Toxicol 2020;141:111358. doi: 10.1016/j.fct.2020.111358Liu W Irudayaraj J Perfluorooctanoic acid (PFOA) exposure inhibits DNA methyltransferase activities and alters constitutive heterochromatin organization Food Chem Toxicol 2020141111358 10.1016/j.fct.2020.111358Open DOISearch in Google Scholar

Pierozan P, Jerneren F, Karlsson O. Perfluorooctanoic acid (PFOA) exposure promotes proliferation, migration and invasion potential in human breast epithelial cells. Arch Toxicol 2018;92:1729–39. doi: 10.1007/s00204-018-2181-4Pierozan P Jerneren F Karlsson O Perfluorooctanoic acid (PFOA) exposure promotes proliferation, migration and invasion potential in human breast epithelial cells Arch Toxicol 2018921729 39 10.1007/s00204-018-2181-4Open DOISearch in Google Scholar

Mignard V, Lalier L, Paris F, Vallette FM. Bioactive lipids and the control of Bax pro-apoptotic activity. Cell Death Dis 2014;5:e1266. doi: 10.1038/cddis.2014.226Mignard V Lalier L Paris F Vallette FM Bioactive lipids and the control of Bax pro-apoptotic activity Cell Death Dis 20145e1266 10.1038/cddis.2014.226Open DOISearch in Google Scholar

Cregan SP, MacLaurin JG, Craig CG, Robertson GS, Nicholson DW, Park DS, Slack RS. Bax-dependent caspase-3 activation is a key determinant in p53-induced apoptosis in neurons. J Neurosci 1999;19:7860–9. doi: 10.1523/JNEUROSCI.19-18-07860.1999Cregan SP MacLaurin JG Craig CG Robertson GS Nicholson DW Park DS Slack RS Bax-dependent caspase-3 activation is a key determinant in p53-induced apoptosis in neurons J Neurosci 1999197860 9 10.1523/JNEUROSCI.19-18-07860.1999Open DOISearch in Google Scholar

Jost CA, Marin MC, Kaelin Jr WG. p73 is a simian [correction of human] p53-related protein that can induce apoptosis. Nature 1997;389:191–4. doi: 10.1038/38298Jost CA Marin MC Kaelin Jr WG p73 is a simian [correction of human] p53-related protein that can induce apoptosis Nature 1997389191 4 10.1038/38298Open DOISearch in Google Scholar

Stiewe T, Pützer BM. p73 in apoptosis. Apoptosis 2001;6:447–52. doi: 10.1023/a:1012433522902Stiewe T Pützer BM p73 in apoptosis Apoptosis 2001644752 10.1023/a:1012433522902Open DOISearch in Google Scholar

Warita K, Mitsuhashi T, Hoshi N, Ohta K, Suzuki S, Takeuchi Y, Miki T. A unique pattern of bisphenol A effects on nerve growth factor gene expression in embryonic mouse hypothalamic cell line N-44. Arh Hig Rada Toksikol 2014;65:293–9. doi: 10.2478/10004-1254-65-2014-2494Warita K Mitsuhashi T Hoshi N Ohta K Suzuki S Takeuchi Y Miki T A unique pattern of bisphenol A effects on nerve growth factor gene expression in embryonic mouse hypothalamic cell line N-44 Arh Hig Rada Toksikol 201465293 9 10.2478/10004-1254-65-2014-2494Open DOISearch in Google Scholar

Pagano M, Pepperkok R, Verde F, Ansorge W, Draetta G. Cyclin A is required at two points in the human cell cycle. EMBO J 1992;11:961–71. PMCID: PMC556537Pagano M Pepperkok R Verde F Ansorge W Draetta G Cyclin A is required at two points in the human cell cycle EMBO J 199211961 71 PMCID: PMC556537Search in Google Scholar

Ohtsubo M, Theodoras AM, Schumacher J, Roberts JM, Pagano M. Human cyclin E, a nuclear protein essential for the G1-to-S phase transition. Mol Cell Biol 1995;15:2612–24. doi: 10.1128/mcb.15.5.2612Ohtsubo M Theodoras AM Schumacher J Roberts JM Pagano M Human cyclin E, a nuclear protein essential for the G1-to-S phase transition Mol Cell Biol 1995152612 24 10.1128/mcb.15.5.2612Open DOISearch in Google Scholar

Brown NR, Lowe ED, Petri E, Skamnaki V, Antrobus R, Johnson L. Cyclin B and cyclin A confer different substrate recognition properties on CDK2. Cell Cycle 2007;6:1350–9. doi: 10.4161/cc.6.11.4278Brown NR Lowe ED Petri E Skamnaki V Antrobus R Johnson L Cyclin B and cyclin A confer different substrate recognition properties on CDK2 Cell Cycle 200761350 9 10.4161/cc.6.11.4278Open DOISearch in Google Scholar

Buhrke T, Krüger E, Pevny S, Rößler M, Bitter K, Lampen A. Perfluorooctanoic acid (PFOA) affects distinct molecular signalling pathways in human primary hepatocytes. Toxicology 2015;333:53–62. doi: 10.1016/j.tox.2015.04.004Buhrke T Krüger E Pevny S Rößler M Bitter K Lampen A Perfluorooctanoic acid (PFOA) affects distinct molecular signalling pathways in human primary hepatocytes Toxicology 201533353 62 10.1016/j.tox.2015.04.004Open DOISearch in Google Scholar

Engeland K. Cell cycle arrest through indirect transcriptional repression by p53: I have a DREAM. Cell Death Differ 2018;25:114–32. doi: 10.1038/cdd.2017.172Engeland K Cell cycle arrest through indirect transcriptional repression by p53: I have a DREAM Cell Death Differ 201825114 32 10.1038/cdd.2017.172Open DOISearch in Google Scholar

Chang BD, Watanabe K, Broude EV, Fang J, Poole JC, Kalinichenko TV, Roninson IB. Effects of p21Waf1/Cip1/Sdi1 on cellular gene expression: Implications for carcinogenesis, senescence, and age-related diseases. Proc Natl Acad Sci USA 2000;97:4291–6. doi: 10.1073/pnas.97.8.4291Chang BD Watanabe K Broude EV Fang J Poole JC Kalinichenko TV Roninson IB Effects of p21Waf1/Cip1/Sdi1 on cellular gene expression: Implications for carcinogenesis, senescence, and age-related diseases Proc Natl Acad Sci USA 2000974291 6 10.1073/pnas.97.8.4291Open DOISearch in Google Scholar

Ferrandiz N, Caraballo JM, Garcia-Gutierrez L, Devgan V, Rodriguez-Paredes M, Lafita MC, Bretones G, Quintanilla A, Munoz-Alonso MJ, Blanco R, Reyes JC, Agell N, Delgado MD, Dotto GP, León J. p21 as a transcriptional co-repressor of S-phase and mitotic control genes. PLoS ONE 2012;7:e37759. doi: 10.1371/journal.pone.0037759Ferrandiz N Caraballo JM Garcia-Gutierrez L Devgan V Rodriguez-Paredes M Lafita MC Bretones G Quintanilla A Munoz-Alonso MJ Blanco R Reyes JC Agell N Delgado MD Dotto GP León J p21 as a transcriptional co-repressor of S-phase and mitotic control genes PLoS ONE 20127e37759 10.1371/journal.pone.0037759Open DOISearch in Google Scholar

Waga S, Hannon GJ, Beach D, Stillman B. The p21 inhibitor of cyclin-dependent kinases controls DNA replication by interaction with PCNA. Nature 1994;369:574–8. doi: 10.1038/369574a0Waga S Hannon GJ Beach D Stillman B The p21 inhibitor of cyclin-dependent kinases controls DNA replication by interaction with PCNA Nature 1994369574 8 10.1038/369574a0Open DOISearch in Google Scholar

Xiong Y, Hannon GJ, Zhang H, Casso D, Kobayashi R, Beach D. p21 is a universal inhibitor of cyclin kinases. Nature 1993;366:701–4. doi: 10.1038/366701a0Xiong Y Hannon GJ Zhang H Casso D Kobayashi R Beach D p21 is a universal inhibitor of cyclin kinases Nature 1993366701 4 10.1038/366701a0Open DOISearch in Google Scholar

Harper JW, Adami GR, Wei N, Keyomarsi K, Elledge SJ. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 1993;75:805–16. doi: 10.1016/0092-8674(93)90499-GHarper JW Adami GR Wei N Keyomarsi K Elledge SJ The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases Cell 199375805 16 10.1016/0092-8674(93)90499-GOpen DOISearch in Google Scholar

De Santi M, Galluzzi L, Lucarini S, Paoletti MF, Fraternale A, Duranti A, De Marco C, Fanelli M, Zaffaroni N, Brandi G, Magnani M. The indole-3-carbinol cyclic tetrameric derivative CTet inhibits cell proliferation via overexpression of p21/CDKN1A in both estrogen receptor-positive and triple-negative breast cancer cell lines. Breast Cancer Res 2011;13:R33. doi: 10.1186/bcr2855De Santi M Galluzzi L Lucarini S Paoletti MF Fraternale A Duranti A De Marco C Fanelli M Zaffaroni N Brandi G Magnani M The indole-3-carbinol cyclic tetrameric derivative CTet inhibits cell proliferation via overexpression of p21/CDKN1A in both estrogen receptor-positive and triple-negative breast cancer cell lines Breast Cancer Res 201113R33 10.1186/bcr2855Open DOISearch in Google Scholar

Kondo S, Barna BP, Kondo Y, Tanaka Y, Casey G, Liu J, Morimura T, Kaakaji R, Peterson JW, Werbel B, Barnett GH. WAF1/CIP1 increases the susceptibility of p53 nonfunctional malignant glioma cells to cisplatin-induced apoptosis. Oncogene 1996;13:1279–85. PMID: 8808702Kondo S Barna BP Kondo Y Tanaka Y Casey G Liu J Morimura T Kaakaji R Peterson JW Werbel B Barnett GH WAF1/CIP1 increases the susceptibility of p53 nonfunctional malignant glioma cells to cisplatin-induced apoptosis Oncogene 1996131279 85 PMID: 8808702Search in Google Scholar

Kreis NN, Sommer K, Sanhaji M, Kramer A, Matthess Y, Kaufmann M, Strebhardt K, Yuan J. Long-term downregulation of Polo-like kinase 1 increases the cyclin-dependent kinase inhibitor p21WAF1/CIP1. Cell Cycle 2009;8:460–72. doi: 10.4161/cc.8.3.7651Kreis NN Sommer K Sanhaji M Kramer A Matthess Y Kaufmann M Strebhardt K Yuan J Long-term downregulation of Polo-like kinase 1 increases the cyclin-dependent kinase inhibitor p21WAF1/CIP1 Cell Cycle 20098460 72 10.4161/cc.8.3.7651Open DOISearch in Google Scholar

Hempstead BL. Dissecting the diverse actions of pro- and mature neurotrophins. Curr Alzheimer Res 2006;3:19–24. doi: 10.2174/156720506775697061Hempstead BL Dissecting the diverse actions of pro- and mature neurotrophins Curr Alzheimer Res 2006319 24 10.2174/156720506775697061Open DOISearch in Google Scholar

Reichardt LF. Neurotrophin-regulated signalling pathways. Philos Trans R Soc Lond B Biol Sci 2006;29:1545–64. doi: 10.1098/rstb.2006.1894 Reichardt LF Neurotrophin-regulated signalling pathways Philos Trans R Soc Lond B Biol Sci 2006291545 64 10.1098/rstb.2006.1894Open DOISearch in Google Scholar

Davey F, Davies AM. TrkB signalling inhibits p75-mediated apoptosis induced by nerve growth factor in embryonic proprioceptive neurons. Curr Biol 1998;8:915–8. doi: 10.1016/s0960-9822(07)00371-5Davey F Davies AM TrkB signalling inhibits p75-mediated apoptosis induced by nerve growth factor in embryonic proprioceptive neurons Curr Biol 19988915 8 10.1016/s0960-9822(07)00371-5Open DOISearch in Google Scholar

Miller FD, Kaplan DR. Neurotrophin signalling pathways regulating neuronal apoptosis. Cell Mol Life Sci 2001;58:1045–53. doi: 10.1007/PL00000919Miller FD Kaplan DR Neurotrophin signalling pathways regulating neuronal apoptosis Cell Mol Life Sci 2001581045 53 10.1007/PL00000919Open DOISearch in Google Scholar

Warita K, Mitsuhashi T, Ohta K, Suzuki S, Hoshi N, Miki T, Takeuchi Y. In vitro evaluation of gene expression changes for gonadotropin-releasing hormone 1, brain-derived neurotrophic factor and neurotrophic tyrosine kinase, receptor, type 2, in response to bisphenol a treatment. Congenit Anom (Kyoto) 2013 ; 53 : 42–5. doi : 10.1111/j.1741-4520.2012.00381.xWarita K Mitsuhashi T Ohta K Suzuki S Hoshi N Miki T Takeuchi Y In vitro evaluation of gene expression changes for gonadotropin-releasing hormone 1, brain-derived neurotrophic factor and neurotrophic tyrosine kinase, receptor, type 2, in response to bisphenol a treatment Congenit Anom (Kyoto) 2013 53 425 10.1111/j.1741-4520.2012.00381.xOpen DOISearch in Google Scholar

Cheow LF, Courtois ET, Tan Y, Viswanathan R, Xing Q, Tan RZ, Tan DSW, Robson P, Loh Y, Quake SR, Burkholder WF. Single-cell multimodal profiling reveals cellular epigenetic heterogeneity. Nat Methods 2016;13:833–6. doi: 10.1038/nmeth.3961Cheow LF Courtois ET Tan Y Viswanathan R Xing Q Tan RZ Tan DSW Robson P Loh Y Quake SR Burkholder WF Single-cell multimodal profiling reveals cellular epigenetic heterogeneity Nat Methods 201613833 6 10.1038/nmeth.3961Open DOISearch in Google Scholar

Cusanovich DA, Hill AJ, Aghamirzaie D, Daza RM, Pliner HA, Berletch JB, Filippova GN, Huang X, Christiansen L, DeWitt WS, Lee C, Regalado SG, Read DF, Steemers FJ, Disteche CM, Trapnell C, Shendure J. A single-cell atlas of in vivo mammalian chromatin accessibility. Cell 2018;174:1309–24. doi: 10.1016/j.cell.2018.06.052Cusanovich DA Hill AJ Aghamirzaie D Daza RM Pliner HA Berletch JB Filippova GN Huang X Christiansen L DeWitt WS Lee C Regalado SG Read DF Steemers FJ Disteche CM Trapnell C Shendure J A single-cell atlas of in vivo mammalian chromatin accessibility Cell 20181741309 24 10.1016/j.cell.2018.06.052Open DOISearch in Google Scholar

Jones PL, Veenstra GJ, Wade PA, Vermaak D, Kass SU, Landsberger N, Strouboulis J, Wolffe AP. Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription. Nat Genet 1998;19:187–91 doi: 10.1038/561Jones PL Veenstra GJ Wade PA Vermaak D Kass SU Landsberger N Strouboulis J Wolffe AP Methylated DNA and MeCP2 recruit histone deacetylase to repress transcription Nat Genet 199819187 91 10.1038/561Open DOISearch in Google Scholar

Chahrour M, Jung SY, Shaw C, Zhou X, Wong ST, Qin J, Zoghbi HY. MeCP2, a key contributor to neurological disease, activates and represses transcription. Science 2008;320:1224–9. doi: 10.1126/science.1153252Chahrour M Jung SY Shaw C Zhou X Wong ST Qin J Zoghbi HY MeCP2, a key contributor to neurological disease, activates and represses transcription Science 20083201224 9 10.1126/science.1153252Open DOISearch in Google Scholar

Recommended articles from Trend MD

Plan your remote conference with Sciendo