Perfluorooctanoic acid (PFOA) is a synthetic surfactant used in various industrial and consumer water- and oil-resistant products with the annual production of several hundred metric tonnes since the 1950s, which makes it one of the most abundantly produced endocrine-disrupting chemicals (EDCs) worldwide (1). Its strong carbon-fluorine bond renders it highly stable and prone to bioaccumulation in the environment (2). It can easily be found in water, food, house dust, stain-resistant carpets, cookware coatings, and industrial waste (3, 4, 5, 6). This indicates a high risk of exposure, which has been confirmed by its discovery in human blood, breast milk, and umbilical cord serum (7, 8, 9, 10, 11). In addition, with its average half-life in humans of 2.4 years (12), PFOA has a potential of high bioaccumulation.
Exposure to EDCs such as PFOA during early development can have lifelong detrimental effects on metabolic homeostasis and endocrine physiology (13, 14). However, while studies demonstrate that development of the embryonic hypothalamus can be disrupted by PFOA, the underlying molecular mechanisms for the metabolic toxicity of PFOA are not yet clear. These involve epigenetic covalent modifications of histone tails (15, 16), small non-coding RNAs that regulate gene expression (17), and DNA methylation (18, 19, 20). Modifications in DNA methylation patterns lead to developmental reprogramming, and these epigenetic changes can be inherited through cell division (21). In addition, transgenerational exposure to EDCs can affect embryonic cell development through genomic imprinting (22). Previous research has shown that PFOA exposure induces changes in global DNA methylation in human umbilical cord serum (23), mouse embryonic fibroblasts (24), and human hepatocellular carcinoma cells (25), but there have been no studies on the effects of PFOA on global DNA methylation in mouse embryonic hypothalamus cells.
To fill this gap, our study focused on epigenetic toxicity and cytotoxicity of PFOA in mHypoE-N46 cells and its effects on gene expression and how it affects apoptosis, cell cycle, proliferation, and neurotrophic genes. In addition, it looked into its effects on gene modifications of ten-eleven translocation methylcytosine dioxygenases (
The mHypoE-N46 (Cellutions Biosystems, Burlington, Canada) cell line, derived from the mouse embryonic hypothalamus was immortalised by retroviral transfer of SV40 T-antigen into embryonic mouse hypothalamic primary cell cultures (days 15, 17, and 18) (26). The cells were cultured as a monolayer in Dulbecco’s modified Eagle medium (DMEM) with 25 mmol/L glucose (Sigma-Aldrich, St. Louis, MO, USA) supplemented with 2 % foetal bovine serum (FBS, Gibco, Carlsbad, CA, USA) and 1 % penicillin/ streptomycin (Welgene, Daegu, Korea). The cells were incubated at 37 °C in 5 % CO2.
PFOA (Sigma-Aldrich) at final concentrations with a 10-fold difference from 0.25 to 250 μmol/L was dissolved in dimethyl sulphoxide (final concentration 0.1 %; Sigma-Aldrich). Dimethyl sulphoxide (0.1 %) was not toxic to the mHypoE-N46 cells and had no effect on cell survival or ability to divide (data not shown). To eliminate the effects of steroids contained in DMEM and FBS, PFOA treatment was performed in phenol red-free DMEM with 25 mmol/L glucose (Gibco), supplemented with 1 % charcoal-stripped FBS and 1 % penicillin/streptomycin.
The cells were seeded at 5x103 cells per well in 96-well plates with 200 μL of fresh complete medium and incubated at 37 °C in 5 % CO2 for 24 h. Cell culture medium (200 μL) was then replaced, and PFOA (at final concentrations of 0, 0.25, 2.5, 25, and 250 μmol/L) was added and incubated for 24 or 48 h. The CellTiter 96® non-radioactive cell proliferation assay kit (Promega, Madison, WI, USA) was used according to the manufacturer’s protocol. The absorbance was read at 570 nm using an enzyme-linked immunosorbent assay (ELISA) microplate reader (Molecular Devices, San Jose, CA, USA). The measured optical density values were normalised and cell viability analysed with the GraphPad Prism Software 7.0 (GraphPad Software, San Diego, CA, USA).
Neurons were harvested and total RNA extracted using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Total RNA purity and concentration were quantified with the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Quantitative real-time PCR was performed using the iTaqTM Universal SYBR® Green One-Step kit (Bio-Rad, Foster, CA, USA) with gene-specific primers (Table 1). Data were analysed using the 2-ΔΔ
List of primer sequences for quantitative real-time polymerase chain reaction
Gene | Primer sequence (5′→3′) | Amplicon size | |
---|---|---|---|
Forward: | TGCAGAGGATGATTGCTGAC | 173 bp | |
Reverse: | GATCAGCTCGGGCACTTTAG | ||
Forward: | CTGCCGGAGTCTGACTGGAA | 97 bp | |
Reverse: | ATCAGTCCCACTGTCTGTCTCAATG | ||
Forward: | AGCCTTTGGTTGACTCCTATCG | 119 bp | |
Reverse: | ACCACCGTGTACCTTGTTCA | ||
Forward: | ACCTGCCTTCACTCATTGCT | 139 bp | |
Reverse: | TGGTGAAGGTCCACAAGACA | ||
Forward: | CAGTTGTGTGCCCAAGAAGA | 216 bp | |
Reverse: | CTACGGAGGAAGTGCAGAGG | ||
Forward: | CACCACTGAGTGCTCCAGAA | 230 bp | |
Reverse: | CTGTTGGCTGACAGTGGAGA | ||
Forward: | GGGATGGCAGTTAGGACTCA | 244 bp | |
Reverse: | GTGGGGCAAGTGCCTAGATA | ||
Forward: | CAATGTTGTACGGCTGATGG | 178 bp | |
Reverse: | CAGGCCGCTTAGAAACTGAC | ||
Forward: | GTCCGCCAGTATGTTGTCAG | 103 bp | |
Reverse: | GTTGCAGGACACGAGGAGTA | ||
Forward: | TCATGGTGCACCGTATCCTA | 170 bp | |
Reverse: | CCTTGGCATGTTCTTCCACT | ||
Forward: | GGTATCCAAAGGCCAACTGA | 183 bp | |
Reverse: | CTTATGAATCGCCAGCCAAT | ||
Forward: | CGCCCTGTGAGCTGAACTCTG | 171 bp | |
Reverse: | CTGCTTCTCAGCTGCCTGACC | ||
Forward: | GAGGTCTCTGTCCAAGTCAGCG | 131 bp | |
Reverse: | TTGAACAACCAGCGCAGAGA | ||
Forward: | CAGACCCGCAACATCACTGTA | 131 bp | |
Reverse: | CCATGGGCCTGGAAGTCTAG | ||
Forward: | CGAAAGAACAGCCACCAGAT | 219 bp | |
Reverse: | TTGCTCTTCTTCCCCATGAC | ||
Forward: | GTTGCAAGAAGAAAGCGGAG | 229 bp | |
Reverse: | CTCTGCCCTTGCTGAAGGT | ||
Forward: | TCCGGATTGAGAAGGTCATC | 176 bp | |
Reverse: | CCAGGCCAGGATCAAGATAA | ||
Forward: | CCTAGTTCCGTGGCTACGAGGAGAA | 136 bp | |
Reverse: | TCTCTCTCCTCTGCAGCCGACTCA | ||
Forward: | CACAGGGCCCGTTACTTCTG | 76 bp | |
Reverse: | TCCAGCTTATCATTCACAGTGGAT | ||
Forward: | TTCAGTGACCAGTCCTCAGACACGAA | 144 bp | |
Reverse: | TCAGAAGGCTGGAGACCTCCCTCTT | ||
Forward: | AGGAGAGACTGGAGGAAAAGT | 70 bp | |
Reverse: | CTTAAACTTCAGTGGCTTGTCT | ||
Forward: | CTCCATAAAAATACAGACTCACCAGT | 183 bp | |
Reverse: | CTTAAACTTCAGTGGCTTGTCT | ||
Forward: | ATGGTGGGAATGGGTCAGAAG | 157 bp | |
Reverse: | CACGCAGCTCATTGTAGAAGG |
Genomic DNA from mHypoE-N46 was extracted immediately after PFOA treatment using the G-spinTM Total DNA Extraction Kit (iNtRON Biotechnology, Seongnam, Korea). Total DNA quantity and quality were tested with the Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific). The whole-genome DNA methylation profile was determined using the EpiGentek MethylFlash Global DNA Methylation (5-mC) ELISA Easy Kit (Epigentek, Farmingdale, NY, USA) following the manufacturer’s protocols.
Results are presented as mean ± SEM (standard error of the mean) and analysed with the GraphPad Prism Software 7.0. Statistical significance at p<0.05 was determined with one-way ANOVA, followed by a Bonferroni
The MTT analysis showed a drop in cell viability in a dose-dependent manner in both 24 and 48-hour PFOA treatment (Figure 1). No statistically significant differences were found between the PFOA concentrations of 0.25 μmol/L and 2.5 μmol/L, but they started to show with 25 μmol/L (p<0.01) and 250 μmol/L (p<0.001). As 48-hour PFOA treatment showed little difference from the 24-hour treatment, all subsequent experiments were done in cells cultured with PFOA for 24 h. IC50 for 24-hour exposure to PFOA was 27.5 μmol/L. Gene expression experiments were therefore performed on cells treated with 2.5 μmol/L and 25 μmol/L of PFOA, whose viability was higher than the IC50.
Because of the previously reported effects of PFOA on cell cycle and proliferation (25, 28, 29, 30) and the strong effect on cell viability found in this study, we decided to continue by testing several genes related to apoptosis, cell cycle, and proliferation.
Figure 2A shows the expression levels of the apoptotic genes
Figure 2B shows the expression patterns of three cell cycle-related genes,
Figure 2C shows the expression levels of
In the nerve growth factor – neurotrophic tyrosine kinase receptor type 1 (NGF-NTRK1) neurotrophin system, the gene expression level of the ligand
In the BDNF-NTRK2 neurotrophin system, 25 μmol/L of PFOA significantly (p<0.01) increased the expression of the ligand
As PFOA showed dose-dependent effects on some genes, we decided to assess global DNA methylation to better understand its effect on genome-wide gene expression. Genome-wide 5-methylcytosine content showed a significant dose-dependent increase compared to control at both PFOA concentrations (p<0.01 at 2.5 μmol/L and p<0.001 at 25 μmol/L) (Figure 4A).
To better understand the mechanism of how methylation levels change, we also analysed relative gene expression of
To determine the effects of PFOA on embryonic hypothalamic cell metabolism, this study evaluated the expression of apoptosis, cell cycle, and cell proliferation genes that play an important role in the development and survival of early neurons. Our results confirmed earlier reports of PFOA cytotoxicity, epigenetic toxicity, and its effects on gene expression and pointed to the mechanisms behind them. The most prominent outcomes of PFOA treatment on mHypoE-N46 cells were a dose dependent drop in cell viability, changes in the expression of some genes related to cell cycle, proliferation, and NGFs, and the activation of apoptosis-related genes. There was a dose-dependent increase in global DNA methylation, and a change in the expression of the
One of the most important findings of this study is the low PFOA IC50 value (27.52 μmol/L), which clearly suggests that embryonic hypothalamic cells are more sensitive to PFOA toxicity than other tissue cells. In previous studies (24, 25, 31, 32), the PFOA IC50 in other cell types was mostly above 200 μmol/L.
Among different genes involved in the neuronal apoptosis mechanism, here we focused on
We were also interested in how PFOA affects the cell cycle. We already know that CCNA2 regulates cell cycle progression by interacting with CDK during both the G1/S and G2/M transition phases (38). CCNB1 and CCNE1 are essential for the G2/M and G1/S transition, respectively (39, 40). Previous studies have shown that exposure to PFOA alters the expression of cyclin-related genes in the human hepatoma cell line (HepG2) and human primary hepatocytes cells (41). With PFOA exposure, such a change in cyclin encoding gene may point to the disturbance in the cell cycle.
Our study also focused on the neurotrophins, which are important for the survival, development, and function of neurons (51, 52), while in embryonic neurons they can regulate apoptosis (53, 54). We analysed relative changes in the expression of
Our findings have also confirmed that PFOA increases overall DNA methylation in embryonic hypothalamic cells in a dose-dependent manner, unlike previous studies showing reduced global DNA methylation in PFOA-treated HepG2 and human breast epithelial cells (MCF7) (25, 31). This can be explained by the reported differences in the patterns of gene expression and epigenetic changes between tissues and cells (56, 57).
To evaluate the initiators of the changes in the patterns of DNA methylation after PFOA treatment we focused on Tets (mouse homologue of human TETs) and Dnmts (mouse homologue of human DNMTs).
Our findings of significantly downregulated expression of
Overall, our findings suggest that exposure to PFOA affects cell survival through the reprogramming of embryonic hypothalamic DNA methylation patterns and altering cell homeostasis genes. They also suggest that DNA methylation and