Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement
, , , , , and
Sep 20, 2024
About this article
Article Category: Original article
Published Online: Sep 20, 2024
Page range: 157 - 170
DOI: https://doi.org/10.2478/abm-2024-0022
Keywords
© 2024 Raziye Akcilar et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.
Figure 1.

Figure 2.

Distribution of ACE2 (G8709A) and AT2R (A1675G) genotypes and alleles frequencies in COVID patients without/with lung involvement
GG | 65 | 55.6 | 52 | 44.4 | 1 | - | 0.29 (0.10–0.84) | 0.01 |
|
GA | 10 | 41.7 | 14 | 58.3 | 1.75 (0.72–4.26) | 0.21 | 0.50 (0.14–1.84) | 0.29 | |
AA | 5 | 26.3 | 14 | 73.7 | 3.50 (1.18–10.3) | 0.001 |
1 | - | |
χ2 = 6.37, df = 2, |
|||||||||
G allele | 140 | 54.3 | 118 | 45.7 | 1 | - | 0.40 (0.22–0.72) | 0.001 |
|
A allele | 20 | 32.3 | 42 | 67.7 | 2.49 (1.39–4.48) | 0.001 |
1 | - | |
χ2 = 9.68, df = 1, |
|||||||||
AA | 37 | 51.4 | 35 | 48.6 | 1.69 (0.76–3.76) | 0.19 | 0.55 (0.26–1.15) | 0.11 | |
AG | 18 | 36.7 | 31 | 63.3 | 3.08 (1.28–7.38) | 0.01 |
1 | ||
GG | 25 | 64.1 | 14 | 35.9 | 1 | 0.33 (0.14–0.78) | 0.01 |
||
χ2 = 6.60, df = 2, |
|||||||||
A allele | 92 | 47.7 | 101 | 52.3 | 1.27 (0.81–1.98) | 0.30 | 1 | ||
G allele | 68 | 53.5 | 59 | 46.5 | 1 | 0.79 (0.50–1.24) | 0.30 | ||
χ2 = 1.05, df = 1, |
Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients with lung involvement
Age (years) | 42.2 ± 14.7 | 30.8 ± 14.3 | 51.8 ± 26.1 | 0.03 |
38.4 ± 16.7 | 44.4 ± 11.8 | 45.6 ± 17.1 | 0.22 |
WBC (103/mm3) | 6.63 ± 2.16 | 5.66 ± 1.91 | 6.00 ± 2.43 | 0.36 | 6.49 ± 2.04 | 6.86 ± 1.94 | 6.17 ± 2.46 | 0.58 |
PLT (103/mm3) | 228.4 ± 64.6 | 235.1 ± 51.7 | 179.0 ± 60.0 | 0.22 | 236.2 ± 618.9 | 228.3 ± 65.4 | 209.6 ± 51.3 | 0.26 |
Neutrophil (103/μL) | 4.35 ± 1.90 | 3.40 ± 1.81 | 4.08 ± 2.52 | 0.35 | 4.16 ± 2.03 | 4.54 ± 1.80 | 4.05 ± 1.91 | 0.69 |
Lymphocyte (103/μL) | 1.64 ± 0.78 | 1.72 ± 0.61 | 1.45 ± 1.23 | 0.83 | 1.71 ± 0.74 | 1.64 ± 0.72 | 1.52 ± 0.89 | 0.64 |
Eosinophil (103/μL) | 00.8 ± 0.08 | 0.06 ± 0.04 | 0.05 ± 0.05 | 0.53 | 0.07 ± 0.07 | 0.07 ± 0.08 | 0.07 ± 0.09 | 0.99 |
Hemoglobin (g/dL) | 14.5 ± 1.83 | 13.2 ± 1.93 | 15.8 ± 0.92 | 0.02 |
14.3 ± 1.71 | 14.3 ± 2.29 | 14.6 ± 1.83 | 0.75 |
D-dimer (μg/mL) | 491.4 ± 349.7 | 559.1 ± 566.6 | 654.6 ± 562.9 | 0.61 | 414.9 ± 340.8 | 641.4 ± 483.6 | 523.1 ± 303.8 | 0.08 |
Fibrinogen (mg/dL) | 345.1 ± 129.6 | 312.7 ± 89.7 | 330.4 ± 87.1 | 0.73 | 324.4 ± 129.0 | 354.9 ± 132.9 | 352.0 ± 92.8 | 0.57 |
Ferritin (ng/mL) | 93.6 ± 131.5 | 45.8 ± 59.0 | 154.8 ± 89.5 | 0.26 | 88.1 ± 144.3 | 95.4 ± 115.5 | 93.0 ± 90.8 | 0.97 |
CRP (mg/L) | 17.9 ± 33.5 | 15.1 ± 19.7 | 42.6 ± 73.9 | 0.31 | 17.9 ± 40.5 | 27.0 ± 42.1 | 15.3 ± 18.7 | 0.55 |
AST (IU/L) | 28.4 ± 18.6 | 23.4 ± 6.60 | 26.6 ± 5.36 | 0.68 | 24.9 ± 8.51 | 30.6 ± 20.0 | 29.6 ± 23.2 | 0.40 |
ALT (IU/L) | 30.1 ± 27.7 | 20.7 ± 11.3 | 35.6 ± 29.3 | 0.49 | 25.1 ± 15.7 | 43.0 ± 46.1 | 25.7 ± 14.9 | 0.04 |
Creatinin (mg/dL) | 0.98 ± 0.18 | 0.78 ± 0.12 | 1.05 ± 0.15 | 0.002 |
0.93 ± 0.18 | 1.02 ± 0.19 | 0.96 ± 0.18 | 0.22 |
Urea (mg/dL) | 27.8 ± 8.75 | 21.5 ± 4.60 | 45.6 ± 28.7 | <0.001 |
27.6 ± 9.00 | 26.4 ± 7.08 | 30.0 ± 16.3 | 0.56 |
Characteristics of the study population
Sex (M/F) n (%) | 42 (52.5)/38 (47.5) | 39 (48.8)/41 (51.2) | 0.63 |
Age (years) | 41.3 ± 16.0 | 48.3 ± 16.7 | 0.20 |
WBC (103/mm3) | 6.47 ± 2.14 | 6.96 ± 3.26 | 0.008 |
PLT (103/mm3) | 226.1 ± 63.4 | 213.0 ± 57.4 | 0.44 |
Neutrophil (103/μL) | 4.21 ± 1.93 | 4.84 ± 2.80 | 0.023 |
Lymphocyte (103/μL) | 1.64 ± 0.78 | 1.60 ± 0.80 | 0.45 |
Eosinophil (103/μL) | 00.7 ± 0.08 | 0.05 ± 0.10 | 0.65 |
Hemoglobin (g/dL) | 14.4 ± 1.87 | 13.9 ± 2.42 | 0.40 |
D-dimer (μg/mL) | 510.0 ± 391.9 | 825.7 ± 818.3 | <0.001 |
Fibrinogen (mg/dL) | 340.1 ± 122.6 | 429.9 ± 126.2 | 0.07 |
Ferritin (ng/mL) | 91.4 ± 123.8 | 253.3 ± 323.4 | <0.001 |
CRP (mg/L) | 19.1 ± 35.6 | 55.3 ± 67.3 | <0.001 |
AST (IU/L) | 27.6 ± 17.0 | 32.3 ± 15.8 | 0.25 |
ALT (IU/L) | 29.3 ± 26.3 | 29.5 ± 15.5 | 0.34 |
Creatinin (mg/dL) | 0.96 ± 0.18 | 1.04 ± 0.57 | 0.27 |
Urea (mg/dL) | 28.1 ± 11.4 | 34.4 ± 22.3 | 0.018 |
Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients without lung involvement
Age (years) | 49.9 ± 16.7 | 43.0 ± 17.6 | 48.0 ± 15.8 | 0.39 | 49.9 ± 17.2 | 45.3 ± 18.9 | 51.4 ± 7.90 | 0.43 |
WBC (103/mm3) | 7.21 ± 3.27 | 5.98 ± 2.02 | 6.98 ± 4.18 | 0.46 | 6.65 ± 2.50 | 7.06 ± 3.79 | 7.49 ± 3.83 | 0.70 |
PLT (103/mm3) | 213.2 ± 61.0 | 214.6 ± 48.2 | 210.5 ± 55.2 | 0.98 | 208.4 ± 55.3 | 217.6 ± 59.4 | 214.4 ± 61.0 | 0.80 |
Neutrophil (103/μL) | 5.08 ± 2.81 | 3.70 ± 1.68 | 5.06 ± 3.52 | 0.25 | 4.71 ± 2.39 | 4.74 ± 3.06 | 5.38 ± 3.31 | 0.73 |
Lymphocyte (103/μL) | 1.61 ± 0.84 | 1.78 ± 0.70 | 1.36 ± 0.71 | 0.39 | 1.45 ± 0.71 | 1.79 ± 0.98 | 1.55 ± 0.45 | 0.21 |
Eosinophil (103/μL) | 00.6 ± 0.12 | 0.04 ± 0.04 | 0.06 ± 0.09 | 0.82 | 0.05 ± 0.08 | 0.07 ± 0.14 | 0.04 ± 0.07 | 0.62 |
Hemoglobin (g/dL) | 13.6 ± 2.70 | 14.4 ± 1.78 | 14.2 ± 1.75 | 0.47 | 13.6 ± 3.03 | 13.9 ± 1.88 | 14.3 ± 1.68 | 0.61 |
D-dimer (μg/mL) | 988.3 ± 941.2 | 534.5 ± 386.6 | 513.1 ± 376.7 | 0.05 |
914.5 ± 1044.5 | 784.0 ± 381.8 | 696.2 ± 914.2 | 0.66 |
Fibrinogen (mg/dL) | 455.9 ± 139.1 | 384.2 ± 97.9 | 379.2 ± 59.0 | 0.04 |
442.1 ± 131.5 | 425.7 ± 129.4 | 408.7 ± 109.4 | 0.69 |
Ferritin (ng/mL) | 289.3 ± 374.0 | 164.2 ± 133.4 | 208.5 ± 230.1 | 0.37 | 297.9 ± 362.6 | 148.0 ± 179.0 | 374.7 ± 412.3 | 0.05 |
CRP (mg/L) | 68.2 ± 76.6 | 32.1 ± 38.4 | 30.6 ± 32.7 | 0.06 | 67.4 ± 80.8 | 37.3 ± 44.8 | 65.0 ± 67.1 | 0.16 |
AST (IU/L) | 34.0 ± 17.3 | 30.7 ± 13.9 | 27.1 ± 10.7 | 0.32 | 29.9 ± 14.1 | 29.3 ± 9.42 | 44.6 ± 24.6 | 0.005 |
ALT (IU/L) | 31.7 ± 16.9 | 26.9 ± 12.2 | 23.6 ± 10.9 | 0.17 | 27.8 ± 16.1 | 26.0 ± 12.2 | 41.2 ± 15.7 | 0.005 |
Creatinin (mg/dL) | 1.09 ± 0.69 | 0.96 ± 0.18 | 0.97 ± 0.27 | 0.67 | 1.16 ± 0.83 | 0.93 ± 0.21 | 0.99 ± 0.13 | 0.25 |
Urea (mg/dL) | 36.6 ± 25.3 | 31.8 ± 17.3 | 28.7 ± 12.0 | 0.45 | 39.5 ± 29.9 | 30.1 ± 13.8 | 30.7 ± 10.8 | 0.19 |
Hardy–Weinberg equilibrium for ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID patients without/with lung involvement
GG | 65 | 61.3 | 14.6 | <0.001 |
G | 0.13 |
GA | 10 | 17.5 | A | 0.87 | ||
AA | 5 | 1.3 | ||||
GG | 52 | 43.5 | 24 | <0.001 |
G | 0.26 |
GA | 14 | 31 | A | 0.74 | ||
AA | 14 | 5.5 | ||||
AA | 37 | 26.5 | 23.2 | <0.001 |
A | 0.43 |
AG | 18 | 39.1 | G | 0.57 | ||
GG | 25 | 14.5 | ||||
AA | 35 | 31.9 | 2.24 | 0.133 | A | 0.37 |
AG | 31 | 37.2 | G | 0.63 | ||
GG | 14 | 10.9 |
Summary of conditions for the ACE2 G8790A and AT2R A1675G genetic analyses
Primer sequence (5′–3′) | F:CATGTGGTCAAAAGGATATCT | F:AGAGATCTGGTGCTATTACG |
R:AAAGTAAGGTTGGCAGACAT | R:CACTTGAAGACTTACTGGTTG | |
PCR reaction conditions |
94°C for 10 min 10 cycles of 94°C for 1 min, 65°C for 1 min, 72°C for 1 min 15 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min 20 cycles of 94°C for 1 min, 58°C for 1 min, 72°C for 1 min 72°C for 10 min. |
95°C for 5 min 35 cycles of 94°C for 45 s, 55°C for 1 min, 72°C for 1 min 72°C for 7 min. |
PCR product size | 466 bp | 310 bp |
Restriction enzyme, incubation conditions | Alu I | HYP 188 III |
37°C overnight | 37°C overnight | |
Fragment length (bp) | GG: 466 bp | AA: 310 bp |
GA: 185 bp–281 bp–466 bp | GA: 104 bp–206 bp–310 bp | |
AA: 185 bp–281 bp | GG: 104 bp–206 bp |