Otwarty dostęp

Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement

Raziye Akcilar

Raziye Akcilar

Department of Physiology, Kütahya Health Sciences University, Faculty of MedicineKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Akcilar, Raziye
, 
Fatma Emel Kocak

Fatma Emel Kocak

Department of Medical Biochemistry, Kütahya Health Sciences University, Faculty of MedicineKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Kocak, Fatma Emel
, 
Fatih Kar

Fatih Kar

Department of Basic Sciences, Kütahya Health Sciences University, Faculty of Natural and Engineering SciencesKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Kar, Fatih
, 
Ozben Ozden Isiklar

Ozben Ozden Isiklar

Department of Medical Biochemistry, Kütahya Health Sciences University, Faculty of MedicineKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Isiklar, Ozben Ozden
, 
Sahinde Atlanoglu

Sahinde Atlanoglu

Department of Radiology, Kütahya Health Sciences University, Faculty of MedicineKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Atlanoglu, Sahinde
, 
Ozlem Genc

Ozlem Genc

Department of Medical Microbiology, Kütahya Health Sciences University, Faculty of MedicineKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Genc, Ozlem
 oraz 
Fatima Yaman

Fatima Yaman

Department of Physical Medicine and Rehabilitation, Kütahya Health Sciences University, Faculty of MedicineKutahya, Turkey
Wyszukaj tego autora
Sciendo|Google Scholar
Yaman, Fatima
  
20 wrz 2024
Evaluation of the relationship between ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID-19 patients with and without lung involvement's Cover Image
O artykule
Poprzedni artykuł
Następny artykuł
Zacytuj
Pobierz okładkę
Kategoria artykułu: Original article
Data publikacji: 20 wrz 2024
Zakres stron: 157 - 170
DOI: https://doi.org/10.2478/abm-2024-0022
Słowa kluczowe
© 2024 Raziye Akcilar et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1.

Electrophoresis of ACE2 G8709A (rs2285666) gene polymorphism by enzyme digestion product sizes were 466 bp for GG genotype, 185 bp–281 bp–466 bp for GA genotype, and 185 bp–281 bp for AA genotype. Lanes 1 and 2 are the GG genotype; lanes 3 and 4 are the GA genotype; lanes 5 and 6 are the AA genotype; lanes 7 and 8 are the PCR products (466 bp). ACE2, angiotensin-converting enzyme 2; M, DNA molecular weight marker.
Electrophoresis of ACE2 G8709A (rs2285666) gene polymorphism by enzyme digestion product sizes were 466 bp for GG genotype, 185 bp–281 bp–466 bp for GA genotype, and 185 bp–281 bp for AA genotype. Lanes 1 and 2 are the GG genotype; lanes 3 and 4 are the GA genotype; lanes 5 and 6 are the AA genotype; lanes 7 and 8 are the PCR products (466 bp). ACE2, angiotensin-converting enzyme 2; M, DNA molecular weight marker.

Figure 2.

Electrophoresis of AT2R A1675G (rs14035430) gene polymorphism by enzyme digestion product sizes were 310 bp for AA genotype, 104 bp–206 bp–310 bp for AG genotype, and 104 bp–206 bp for GG genotype. Lanes 1, 8, and 9 are the AA genotype; lanes 4, 5, and 7 are the AG genotype; lanes 2, 3, and 6 are the GG genotype. AT2R, angiotensin II type 2 receptor; M, DNA molecular weight marker.
Electrophoresis of AT2R A1675G (rs14035430) gene polymorphism by enzyme digestion product sizes were 310 bp for AA genotype, 104 bp–206 bp–310 bp for AG genotype, and 104 bp–206 bp for GG genotype. Lanes 1, 8, and 9 are the AA genotype; lanes 4, 5, and 7 are the AG genotype; lanes 2, 3, and 6 are the GG genotype. AT2R, angiotensin II type 2 receptor; M, DNA molecular weight marker.

Distribution of ACE2 (G8709A) and AT2R (A1675G) genotypes and alleles frequencies in COVID patients without/with lung involvement

Control Group Infected Group OR (95% CI) P-value OR (95% CI) P-value
n = 80 % n = 80 %
GG 65 55.6 52 44.4 1 - 0.29 (0.10–0.84) 0.01*
GA 10 41.7 14 58.3 1.75 (0.72–4.26) 0.21 0.50 (0.14–1.84) 0.29
AA 5 26.3 14 73.7 3.50 (1.18–10.3) 0.001** 1 -
ACE2 G8709A (rs2285666) χ2 = 6.37, df = 2, P = 0.04*
G allele 140 54.3 118 45.7 1 - 0.40 (0.22–0.72) 0.001**
A allele 20 32.3 42 67.7 2.49 (1.39–4.48) 0.001** 1 -
χ2 = 9.68, df = 1, P = 0.002**
AA 37 51.4 35 48.6 1.69 (0.76–3.76) 0.19 0.55 (0.26–1.15) 0.11
AG 18 36.7 31 63.3 3.08 (1.28–7.38) 0.01* 1
GG 25 64.1 14 35.9 1 0.33 (0.14–0.78) 0.01*
AT2R A1675G (rs14035430) χ2 = 6.60, df = 2, P = 0.03*
A allele 92 47.7 101 52.3 1.27 (0.81–1.98) 0.30 1
G allele 68 53.5 59 46.5 1 0.79 (0.50–1.24) 0.30
χ2 = 1.05, df = 1, P = 0.30

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients with lung involvement

Variables Infected group (n = 80)
ACE2 G8709A genotype AT2R A1675G genotype
GG GA AA P-value AA AG GG P-value
Age (years) 42.2 ± 14.7 30.8 ± 14.3 51.8 ± 26.1 0.03* 38.4 ± 16.7 44.4 ± 11.8 45.6 ± 17.1 0.22
WBC (103/mm3) 6.63 ± 2.16 5.66 ± 1.91 6.00 ± 2.43 0.36 6.49 ± 2.04 6.86 ± 1.94 6.17 ± 2.46 0.58
PLT (103/mm3) 228.4 ± 64.6 235.1 ± 51.7 179.0 ± 60.0 0.22 236.2 ± 618.9 228.3 ± 65.4 209.6 ± 51.3 0.26
Neutrophil (103/μL) 4.35 ± 1.90 3.40 ± 1.81 4.08 ± 2.52 0.35 4.16 ± 2.03 4.54 ± 1.80 4.05 ± 1.91 0.69
Lymphocyte (103/μL) 1.64 ± 0.78 1.72 ± 0.61 1.45 ± 1.23 0.83 1.71 ± 0.74 1.64 ± 0.72 1.52 ± 0.89 0.64
Eosinophil (103/μL) 00.8 ± 0.08 0.06 ± 0.04 0.05 ± 0.05 0.53 0.07 ± 0.07 0.07 ± 0.08 0.07 ± 0.09 0.99
Hemoglobin (g/dL) 14.5 ± 1.83 13.2 ± 1.93 15.8 ± 0.92 0.02* 14.3 ± 1.71 14.3 ± 2.29 14.6 ± 1.83 0.75
D-dimer (μg/mL) 491.4 ± 349.7 559.1 ± 566.6 654.6 ± 562.9 0.61 414.9 ± 340.8 641.4 ± 483.6 523.1 ± 303.8 0.08
Fibrinogen (mg/dL) 345.1 ± 129.6 312.7 ± 89.7 330.4 ± 87.1 0.73 324.4 ± 129.0 354.9 ± 132.9 352.0 ± 92.8 0.57
Ferritin (ng/mL) 93.6 ± 131.5 45.8 ± 59.0 154.8 ± 89.5 0.26 88.1 ± 144.3 95.4 ± 115.5 93.0 ± 90.8 0.97
CRP (mg/L) 17.9 ± 33.5 15.1 ± 19.7 42.6 ± 73.9 0.31 17.9 ± 40.5 27.0 ± 42.1 15.3 ± 18.7 0.55
AST (IU/L) 28.4 ± 18.6 23.4 ± 6.60 26.6 ± 5.36 0.68 24.9 ± 8.51 30.6 ± 20.0 29.6 ± 23.2 0.40
ALT (IU/L) 30.1 ± 27.7 20.7 ± 11.3 35.6 ± 29.3 0.49 25.1 ± 15.7 43.0 ± 46.1 25.7 ± 14.9 0.04*
Creatinin (mg/dL) 0.98 ± 0.18 0.78 ± 0.12 1.05 ± 0.15 0.002** 0.93 ± 0.18 1.02 ± 0.19 0.96 ± 0.18 0.22
Urea (mg/dL) 27.8 ± 8.75 21.5 ± 4.60 45.6 ± 28.7 <0.001** 27.6 ± 9.00 26.4 ± 7.08 30.0 ± 16.3 0.56

Characteristics of the study population

Variables Control Group n = 80 Infected Group n = 80 P-value
Sex (M/F) n (%) 42 (52.5)/38 (47.5) 39 (48.8)/41 (51.2) 0.63
Age (years) 41.3 ± 16.0 48.3 ± 16.7 0.20
WBC (103/mm3) 6.47 ± 2.14 6.96 ± 3.26 0.008**
PLT (103/mm3) 226.1 ± 63.4 213.0 ± 57.4 0.44
Neutrophil (103/μL) 4.21 ± 1.93 4.84 ± 2.80 0.023*
Lymphocyte (103/μL) 1.64 ± 0.78 1.60 ± 0.80 0.45
Eosinophil (103/μL) 00.7 ± 0.08 0.05 ± 0.10 0.65
Hemoglobin (g/dL) 14.4 ± 1.87 13.9 ± 2.42 0.40
D-dimer (μg/mL) 510.0 ± 391.9 825.7 ± 818.3 <0.001**
Fibrinogen (mg/dL) 340.1 ± 122.6 429.9 ± 126.2 0.07
Ferritin (ng/mL) 91.4 ± 123.8 253.3 ± 323.4 <0.001**
CRP (mg/L) 19.1 ± 35.6 55.3 ± 67.3 <0.001**
AST (IU/L) 27.6 ± 17.0 32.3 ± 15.8 0.25
ALT (IU/L) 29.3 ± 26.3 29.5 ± 15.5 0.34
Creatinin (mg/dL) 0.96 ± 0.18 1.04 ± 0.57 0.27
Urea (mg/dL) 28.1 ± 11.4 34.4 ± 22.3 0.018*

Analysis of the influence of ACE2 G8790A and AT2R A1675G gene polymorphisms on clinical-laboratory variables in COVID-19 patients without lung involvement

Variables Control Group (n = 80)
ACE2 G8709A genotype AT2R A1675G genotype
GG GA AA P-value AA AG GG P-value
Age (years) 49.9 ± 16.7 43.0 ± 17.6 48.0 ± 15.8 0.39 49.9 ± 17.2 45.3 ± 18.9 51.4 ± 7.90 0.43
WBC (103/mm3) 7.21 ± 3.27 5.98 ± 2.02 6.98 ± 4.18 0.46 6.65 ± 2.50 7.06 ± 3.79 7.49 ± 3.83 0.70
PLT (103/mm3) 213.2 ± 61.0 214.6 ± 48.2 210.5 ± 55.2 0.98 208.4 ± 55.3 217.6 ± 59.4 214.4 ± 61.0 0.80
Neutrophil (103/μL) 5.08 ± 2.81 3.70 ± 1.68 5.06 ± 3.52 0.25 4.71 ± 2.39 4.74 ± 3.06 5.38 ± 3.31 0.73
Lymphocyte (103/μL) 1.61 ± 0.84 1.78 ± 0.70 1.36 ± 0.71 0.39 1.45 ± 0.71 1.79 ± 0.98 1.55 ± 0.45 0.21
Eosinophil (103/μL) 00.6 ± 0.12 0.04 ± 0.04 0.06 ± 0.09 0.82 0.05 ± 0.08 0.07 ± 0.14 0.04 ± 0.07 0.62
Hemoglobin (g/dL) 13.6 ± 2.70 14.4 ± 1.78 14.2 ± 1.75 0.47 13.6 ± 3.03 13.9 ± 1.88 14.3 ± 1.68 0.61
D-dimer (μg/mL) 988.3 ± 941.2 534.5 ± 386.6 513.1 ± 376.7 0.05* 914.5 ± 1044.5 784.0 ± 381.8 696.2 ± 914.2 0.66
Fibrinogen (mg/dL) 455.9 ± 139.1 384.2 ± 97.9 379.2 ± 59.0 0.04* 442.1 ± 131.5 425.7 ± 129.4 408.7 ± 109.4 0.69
Ferritin (ng/mL) 289.3 ± 374.0 164.2 ± 133.4 208.5 ± 230.1 0.37 297.9 ± 362.6 148.0 ± 179.0 374.7 ± 412.3 0.05*
CRP (mg/L) 68.2 ± 76.6 32.1 ± 38.4 30.6 ± 32.7 0.06 67.4 ± 80.8 37.3 ± 44.8 65.0 ± 67.1 0.16
AST (IU/L) 34.0 ± 17.3 30.7 ± 13.9 27.1 ± 10.7 0.32 29.9 ± 14.1 29.3 ± 9.42 44.6 ± 24.6 0.005**
ALT (IU/L) 31.7 ± 16.9 26.9 ± 12.2 23.6 ± 10.9 0.17 27.8 ± 16.1 26.0 ± 12.2 41.2 ± 15.7 0.005**
Creatinin (mg/dL) 1.09 ± 0.69 0.96 ± 0.18 0.97 ± 0.27 0.67 1.16 ± 0.83 0.93 ± 0.21 0.99 ± 0.13 0.25
Urea (mg/dL) 36.6 ± 25.3 31.8 ± 17.3 28.7 ± 12.0 0.45 39.5 ± 29.9 30.1 ± 13.8 30.7 ± 10.8 0.19

Hardy–Weinberg equilibrium for ACE2 G8790A and AT2R A1675G gene polymorphisms in COVID patients without/with lung involvement

Genotype Observed Expected χ2 P-value Alleles Frequency
ACE2
Control group
GG 65 61.3 14.6 <0.001** G 0.13
GA 10 17.5 A 0.87
AA 5 1.3
Infected group
GG 52 43.5 24 <0.001** G 0.26
GA 14 31 A 0.74
AA 14 5.5
AT2R
Control group
AA 37 26.5 23.2 <0.001** A 0.43
AG 18 39.1 G 0.57
GG 25 14.5
Infected group
AA 35 31.9 2.24 0.133 A 0.37
AG 31 37.2 G 0.63
GG 14 10.9

Summary of conditions for the ACE2 G8790A and AT2R A1675G genetic analyses

ACE2 G8790A (rs2285666) AT2R A1675G (rs14035430)
Primer sequence (5′–3′) F:CATGTGGTCAAAAGGATATCT F:AGAGATCTGGTGCTATTACG
R:AAAGTAAGGTTGGCAGACAT R:CACTTGAAGACTTACTGGTTG
PCR reaction conditions

94°C for 10 min

10 cycles of 94°C for 1 min, 65°C for 1 min, 72°C for 1 min

15 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 1 min

20 cycles of 94°C for 1 min, 58°C for 1 min, 72°C for 1 min

72°C for 10 min.

95°C for 5 min

35 cycles of 94°C for 45 s, 55°C for 1 min, 72°C for 1 min

72°C for 7 min.
PCR product size 466 bp 310 bp
Restriction enzyme, incubation conditions Alu I HYP 188 III
37°C overnight 37°C overnight
Fragment length (bp) GG: 466 bp AA: 310 bp
GA: 185 bp–281 bp–466 bp GA: 104 bp–206 bp–310 bp
AA: 185 bp–281 bp GG: 104 bp–206 bp
Język:
Angielski
Częstotliwość wydawania:
6 razy w roku
Dziedziny czasopisma:
Medycyna, Zawody pomocnicze, pielęgniarstwo, Podstawowe nauki medyczne, Podstawowe nauki medyczne, inne, Medycyna kliniczna, Medycyna kliniczna, inne
Kanał RSS czasopisma