Shiga toxin-producing
STEC serotypes produce high levels of various toxins in the large intestine which are closely related to the potent cytotoxins produced by
The knowledge of how to reduce the incidence of STEC on cattle farms still needs to be elucidated. However, tests can be performed to determine whether a given animal carries the bacterium. If necessary, meat can be given bactericidal treatment, which involves heating or irradiation. Although these techniques are helpful, they do not guarantee the absence of STEC in food. Effective prevention requires the application of strict hygiene practices throughout the entire food chain, from producer to consumer. To prevent infection, children under the age of 5 should not come into contact with farm animals, especially cattle and sheep, and their environment as well as should avoid eating unpasteurized cheese or not washed fruits, vegetables, and herbs if they are eaten raw; nor drink water that has not undergone microbiological testing, e.g., from a well or spring (The Institut Pasteur 2023).
The aim of the study was to evaluate epidemiological characteristics of Shiga toxin-producing
Clinical samples. The study was conducted from January 1st, 2018-December 31st, 2022. All consecutive samples delivered for STEC routine testing in the Microbiology Laboratory of the University Medical Center of the Medical University of Warsaw were included in the study. A total of 180 stool samples from children suspected of HUS were included in the study. The samples came from five pediatric medical centers from five voivodeships: Mazovian, Podlaskie, Greater Poland, Lublin, and Warmian-Masurian.
Detection of the presence of
All examined samples were cultured on MacConkey agar to select
Primer and probe sequences applied in this study were previously reported and described by Perelle et al. (2004; 2005) (
Characteristics of primers and probes used in the study.
Gene name | GenBank Access No. | Nucleotide sequences (5’→3’)* | Amplicon size (bp) |
---|---|---|---|
M16625 | Fw**: TTTGTYACTGTSACAGCWGAAGCYTTACG | 132 | |
Rv**: CCCCAGTTCARWGTRAGRTCMACRTC | |||
Probe: CTGGATGATCTCAGTGGGCGTTCTTATGTAA | |||
X07865 | Fw: TTTGTYACTGTSACAGCWGAAGCYTTACG | 128 | |
Rv: CCCCAGTTCARWGTRAGRTCMACRTC | |||
Probe: TCGTCAGGCACTGTCTGAAACTGCTCC | |||
Z11541 | Fw: CATTGATCAGGATTTTTCTGGTGATA | 102 | |
Rv: CTCATGCGGAAATAGCCGTTA | |||
Poll: ATAGTCTCGCCAGTATTCGCCACCAATACC |
* – in the sequences, Y is (C/T), S is (C/G), W is (A/T), R is (A/G), and M is (A/C)
** – Fw – forward primer, Rev – reverse primer
Antimicrobial susceptibility testing (AST) was performed using a VITEK® 2 instrument (bioMérieux, France) for all antibiotics except azithromycin. For azithromycin susceptibility testing an MTS™ MIC Test Strip (Liofilchem S.r.l., Italy) was used and plated on Mueller-Hinton agar (Oxoid, Thermo Fisher Scientific, Inc., USA) according to the manufacturer’s instructions. Results were interpreted according to EUCAST v. 12 breakpoints (EUCAST 2022). Breakpoints for azithromycin were taken from the
The analysis was performed using the CHEF-DR® II instrument (Bio-Rad, USA) according to the procedure described by Kawamori et al. (2008) with minor modifications.
Not applicable. Medical information was collected from medical records after the discharge of patients.
Medical information was collected from medical records after the discharge of patients.
A total of 180 stool samples from children suspected of HUS were included in the study. The samples came from five pediatric medical centers from five voivodeships: Mazovian, Podlaskie, Greater Poland, Lublin, and Warmian-Masurian.
Medical documentation was analyzed in terms of contact with animals (e.g. domestic, farm, zoo), eating unwashed fruit, and vegetables, visiting a mini zoo, participating in scout camps.
The study was limited to children with HUS suspected who were hospitalized in tertiary hospitals.
Medical documentation was analyzed regarding diarrhea onset, platelet concentration, treatment results, recovery, and HUS complications.
Statistical analyses were performed in Statistica 13 (StatSoft, Inc., USA). The relationships between variables were evaluated using the following statistical tests: Shapiro-Wilk test for normality, Levene test for equality of variances, independent
In 2018–2022, a total of 45 Shiga toxin-producing isolates were detected. One strain could not be cultured. The
Characteristics of patients infected with STEC as diagnosed in the Medical Center of the Medical University of Warsaw, 2018–2022.
Characteristic of STEC patients | Value (No.) |
---|---|
Boys | 26 |
Girls | 19 |
Median age (range) | 2 years 8 months (1 month–16 years and 6 months) |
Clinical manifestation | Value (No.) |
HUS | 20 |
Only diarrhea | 4 |
No data | 21 |
Laboratory results | No. cases/No. total |
Direct positive PCR for |
45/45 |
Positive culture of STEC | 44/45 |
PCR gene detection results | No. cases/No. total |
3/45 | |
38/45 | |
3/45 | |
1/45 | |
44/45 | |
Serotypes | No. total |
O157 | 40 |
other than O157 | 1 |
1 –
3 –
For 41 tested isolates, 97.6% (40/41) belonged to serotype O157, and 2.4 % (1/41) belonged to a serogroup other than O157 (Table II).
Antimicrobial susceptibility tests were performed for 33 strains. The antimicrobial resistance was found to amoxicillin/clavulanic acid (24.4%), piperacillin/tazobactam (3%), cefotaxime (6%), gentamicin (6%), ciprofloxacin (3%), azithromycin (3%), trimethoprim/sulfamethoxazole (24.2%). None of the thirty-three strains produced ESBL. The sensitivity of the tested STEC strains is presented in Fig. 1. Due to the group size being too small, it was not possible to conduct a statistical analysis of the antibiotic sensitivity of the isolates in terms of the patient’s age and gender and the presence of significant or insignificant HUS risk factors.
Antibiotic susceptibility of STEC isolates (n = 33).
AMC – amoxicillin/clavulanic acid, TZP – piperacillin/tazobactam, CTX – cefotaxime, CXM – cefuroxime, CAZ – ceftazidime, FEP – cefepime, IPM – imipenem, MEM – meropenem, AK – amikacin, CN – gentamicin, TOB – tobramycin, CIP – ciprofloxacin, SXT – trimethoprim/sulfamethoxazole, AZT – azithromycin.
The seasonality of infections caused by STEC has been demonstrated. Infections most often occurred from June to October, with a peak in July and August (51%) (Fig. 2).
Percentage of STEC isolates by month, 2018–2022 (n = 45).
Most STEC isolates were detected among children aged 1–5 years – 77.8% (35/45). Lower percentages of 15.6% (7/45), 4.4% (2/45), and 2.2% (1/45) occurred among age groups below one year, 12–16 years, and over 16 years, respectively. In order to check whether the occurrence of genes is age-dependent, patients were divided into two groups. The first group included children up to 2 years of age (median age), and the second group included other patients. There were no statistical differences between groups (
There was no relationship between STEC infections and gender: 19/45 (42.2%) girls vs. 26/45 (57.8%) boys (Table II). The occurrence of the above
Isolates were most often detected in patients hospitalized in the voivodeships Masovian and Podlaskie, 51.2% and 28.9%, respectively. In other voivodeships, this percentage was 12%.
The most common risk factors for HUS in our patients with STEC isolate included living on a farm (most often cattle were bred), eating unwashed fruit and vegetables, visiting a mini zoo, or participating in scout camps.
The time interval from the onset of diarrhea to HUS in patients ranged from 1 to 8 days. The range of platelet concentrations in patients with confirmed STEC infection was from 6–201 × 103/μl.
According to available data from 18 patients, the most common result was complete recovery – in 83.3% of patients (15/18). Reported complications of HUS in the studied children were neurological complications and insulin-dependent diabetes in 11.1% (2/18) and 5.6% (1/18), respectively.
All analyzed in PFGE strains presented STEC pathotypes with only the stx2 gene. The genetic association was obtained by comparing bands in the analyzed PFGE patterns. Closely related strains were designed based on a difference of up to three bands, related up to eight bands, but unrelated to the difference between the above nine bands in the analyzed PFGE pattern. Unrelated PFGE types were marked with different letters from A to S. Among the 23
PFGE patterns of selected
Molecular characteristic of selected isolates derived from gastrointestinal infections.
PFGE type/subtype | No. of isolates (Total No. 24) | Voivodeship | |
---|---|---|---|
11 | Podlaskie | ||
8 | Mazovian | ||
1 | Mazovian | ||
3 | Warmian-Masurian | ||
L | 1 | Greater Poland |
Genetic relatedness of PFGE types is marked by bold type.
Outbreaks and sporadic cases of STEC have been reported in several countries. Typical HUS caused by STEC presents with acute illness with symptoms of bloody diarrhea. About 25% of typical HUS do not show diarrhea. Almost 90% of individuals recover without sequelae, either spontaneously or after plasma infusion or replacement plasma (Noris et al. 2021). In our study, the most common outcome was complete recovery in 83.3% (15/18) of patients. However, we reported some complications of HUS, such as neurological complications and insulin-dependent diabetes, in 11.1% and 5.6%, respectively.
Our study showed that among the analyzed STEC patients, the
Shiga toxins (ST) are a group of bacterial toxins involved in human and animal diseases. STs are produced by E. coli isolates. Other species reported as ST producers besides S. dysenteriae type 1 are occasionally
The fact that our study mainly includes high-risk STEC might support the serotyping results, as 40 (97.6%) of the strains tested had serotype O157 and encoded the Shiga toxin 2 gene. Reports of non-O157 STEC serotypes associated with severe disease vary among countries. According to the ECDC report, until 2021, the most frequently reported serogroup in human STEC cases was O157, followed by O26, but in recent years, there has been an increasing trend in number of non-O157 STEC infections. The last ECDC report on STEC infections (ECDC 2022) shows serogroup O26 as the most common (34%) among HUS cases, followed by O157 (19.8%). The results of our study concern the period 2018–2022, and sporadic cases of HUS in pediatric population. Detection of the O157 serogroup was not influenced by diagnosis as PCR amplification of Shiga toxin coding genes was applied for detection. Our results agree with some other studies suggesting that
ST production is necessary but not enough for STEC virulence. Shiga toxin production by O157:H7 is mediated by sensing quorum (Mühlen and Dersch 2020). Serotype O157:H7 harbors the locus of the pathogenic enterocyte efflux island, which encodes genes involved in removing intestinal epithelial cell microvilli and the tight adherence of bacteria to the epithelial cell membrane. The molecular mechanism underlying the pathogenicity of different STEC strains requires further elucidation. Stx2d has been described as a Shiga toxin whose cytotoxicity is activated 10- to 1,000-fold by elastase present in the intestinal mucus of mice or man (Matussek et al. 2023). Clinical STEC strains may have the following genes:
The likelihood that a patient infected with
Fatima and Aziz (2023) reported a seasonal pattern of STEC infections, with increased incidence during the summer months. Similarly, in the 2018–2022 analyzed period, we observed that infections most frequently occurred in June, July, August, and September, with a peak in July.
Because antibiotics are strong inducers of the bacterial SOS response, which initiates the production and release of phages from bacteria, antibiotic treatment is not recommended. It was mentioned that bacterial DNA damage due to antibiotic therapy may increase the expression of genes encoding verotoxins and increase the risk of HUS (Noris et al. 2021). It is believed that disease worsening after administration of antibiotics also occurs due to changes in the commensal intestinal flora, which allows STEC to attach to the intestinal wall (Harkins et al. 2020). There is no therapy against STEC infections, and current treatment is only supportive and includes hydration therapy and, if necessary, dialysis (Koyanagi et al. 2019). An
In our study, PFGE analysis of 23 selected E. coli and one C. freundii strain showed 18 PFGE types; however, types A, B, and C with two subtypes showed genetic relatedness. The remaining 15 PFGE types were derived from single patients and were not related to each other. All strains with genetic relatedness have been found in Mazovian voivodeships. However, strains with type B were also found in Podlasie and type C in Warmian-Masurian voivodeships. The STEC strains with A, B, and C PFGE types derived from different persons, times, and areas reflect no epidemic transmission of these strains and show their probable persistence in the environment. On the other hand, the occurrence of the
STEC has been shown to be an important pathogen causing severe post-infectious complications and deaths among the youngest children in Poland. In our study, the genetic diversity of STEC strains was seen. Almost 86.4% of isolates carried the