A Recombinase-Aided Amplification Assay for the Detection of Chlamydia felis
, , , , , , , , , oraz
20 wrz 2023
O artykule
Kategoria artykułu: Short Communication
Data publikacji: 20 wrz 2023
Zakres stron: 339 - 343
Otrzymano: 23 mar 2023
Przyjęty: 30 cze 2023
DOI: https://doi.org/10.33073/pjm-2023-029
Słowa kluczowe
© 2023 Jian Liu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.
Fig. 1.

Sequences of primers and probes in the RAA assay for Chlamydia felis_*
Primers/Probes | Sequence (5′–3′) | Genomic position |
---|---|---|
GAAAGCAAGGGGAGCAAACAGGATT | 769–793 | |
TCAGGCGGCATACTTAACGCGTTAG | 891–867 | |
CGATGCATACTTGATGTGGATAGTCTCAACCC[FAM-dT] |
821–871 |
Comparison of Chlamydia felis detection in 117 swabs examined by RAA and real-time PCR_
Real-time PCR | Performance characteristics | ||||
---|---|---|---|---|---|
Positive | Negative | Sensitivity | Specificity | ||
RAA | Positive | 20 | 0 | 95.24% | 100% |
Negative | 1 | 96 | |||
Total | 21 | 96 |