Uneingeschränkter Zugang

A Recombinase-Aided Amplification Assay for the Detection of Chlamydia felis

Jian Liu

Jian Liu

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Liu, Jian
, 
Weidong Qian

Weidong Qian

School of Food and Biological Engineering, Shaanxi University of Science and TechnologyXi’an, China
Suche nach diesem Autor auf
Sciendo|Google Scholar
Qian, Weidong
, 
Jian Wang

Jian Wang

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Wang, Jian
, 
Yilan Bai

Yilan Bai

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Bai, Yilan
, 
Yaping Gui

Yaping Gui

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Gui, Yaping
, 
Luming Xia

Luming Xia

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Xia, Luming
, 
Guohua Gong

Guohua Gong

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Gong, Guohua
, 
Feifei Ge

Feifei Ge

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ge, Feifei
, 
Haixiao Shen

Haixiao Shen

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Shen, Haixiao
, 
Xiaojing Chang

Xiaojing Chang

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Chang, Xiaojing
 und 
Hongjin Zhao

Hongjin Zhao

Shanghai Animal Disease Prevention and Control CenterChina
Suche nach diesem Autor auf
Sciendo|Google Scholar
Zhao, Hongjin
  
20. Sept. 2023
A Recombinase-Aided Amplification Assay for the Detection of Chlamydia felis's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Artikel-Kategorie: Short Communication
Online veröffentlicht: 20. Sept. 2023
Seitenbereich: 339 - 343
Eingereicht: 23. März 2023
Akzeptiert: 30. Juni 2023
DOI: https://doi.org/10.33073/pjm-2023-029
Schlüsselwörter
© 2023 Jian Liu et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

A) Specificity evaluation of the recombinase-aided amplification (RAA) assay for the detection of Chlamydia felis using genomic DNA from C. felis_pUC57 plasmid, feline calicivirus-SH202101 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline parvovirus/Shanghai/01/2021 (FPV), Mycoplasma felis ATCC® 23391™ (M. felis), and Bordetella bronchiseptica ATCC® 4617™ (B. bronchiseptica), as the templates of RAA, respectively.B) Examination of the RAA assay's sensitivity for detecting Chlamydia felis using a serial dilution of the C. felis_pUC57 plasmid as the template. The lower limit of detection was 10.6 copies/reaction plasmid DNA. The higher the template concentration, the greater the fluorescence value and the earlier the peak time. NC, negative control group. All the experiments were performed at least three times.
A) Specificity evaluation of the recombinase-aided amplification (RAA) assay for the detection of Chlamydia felis using genomic DNA from C. felis_pUC57 plasmid, feline calicivirus-SH202101 (FCV), feline herpesvirus-1/Cat/Shanghai/01/2014 (FHV-1), feline infectious peritonitis virus VR-990 (FIPV), feline parvovirus/Shanghai/01/2021 (FPV), Mycoplasma felis ATCC® 23391™ (M. felis), and Bordetella bronchiseptica ATCC® 4617™ (B. bronchiseptica), as the templates of RAA, respectively.B) Examination of the RAA assay's sensitivity for detecting Chlamydia felis using a serial dilution of the C. felis_pUC57 plasmid as the template. The lower limit of detection was 10.6 copies/reaction plasmid DNA. The higher the template concentration, the greater the fluorescence value and the earlier the peak time. NC, negative control group. All the experiments were performed at least three times.

Sequences of primers and probes in the RAA assay for Chlamydia felis_*

Primers/Probes Sequence (5′–3′) Genomic position†
C. felis F GAAAGCAAGGGGAGCAAACAGGATT 769–793
C. felis R TCAGGCGGCATACTTAACGCGTTAG 891–867
C. felis probe CGATGCATACTTGATGTGGATAGTCTCAACCC[FAM-dT]A(THF)[BHQ1-dT] CCGTGTCGTAGCTAAC(C3-Spacer) 821–871

Comparison of Chlamydia felis detection in 117 swabs examined by RAA and real-time PCR_

Real-time PCR Performance characteristics
Positive Negative Sensitivity Specificity
RAA Positive 20 0 95.24% 100%
Negative 1 96
Total 21 96
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Mikrobiologie und Virologie
Zeitschrift RSS Feed