Bacterial food-borne diseases are an increasing public health concern to the World Health Organization (Johnson 2011). The consumption of food and drinking water contaminated by pathogenic bacteria is the leading cause of food-borne disease outbreaks (Park et al. 2011). More than 250 types of foodborne diseases caused by the pathogen with various virulence genes have been identified (Mangal et al. 2016). In recent years, the number of food-borne diseases caused by
In developed countries, researchers generally do not consider
Bacterial strains used in the specificity assessment.
Strain | Origin | FAM | HEX |
---|---|---|---|
CVCC4106 | − | ||
CVCC1969 | − | ||
ATCC35659 | − | ||
CMCC49001 | − | ||
Isolated by lab | − | ||
Isolated by lab | − | ||
Isolated by lab | − | ||
Isolated by lab | − | ||
ATCC6896 | − | ||
CMCC 49008 | − | ||
CMCC49027 | − | ||
CMCC 49105 | − | ||
Isolated by lab | − | ||
Isolated by lab | − | ||
Isolated by lab | − | ||
ATCC 33519 | − | − | |
NTCC 35198 | − | − | |
ATCC 31052 | − | − | |
CVCC3947 | − | − | |
ATCC9237 | − | − | |
CICC71786 | − | − | |
ATCC14028 | − | − | |
CVCC2227 | − | − | |
Isolated by lab | − | − | |
Isolated by lab | − | − | |
CICC52719 | − | − | |
Isolated by lab | − | − | |
Isolated by lab | − | − | |
ATCC25923 | − | − | |
Isolated by lab | − | − | |
CICC 22936 | − | − | |
Isolated by lab | − | − | |
ATCC29695 | − | − | |
Isolated by lab | − | − | |
CICC6074 | − | − | |
CICC20445 | − | − |
ATCC – American Type Culture Collection; CICC – China Center of Industrial Culture Collection; CMCC – China Medical Culture Collection; CVCC – China Veterinary Culture Collection Center, NTCC – National Type Culture Collection, China
Reagents: The Premix Ex TaqTM (Probe qPCR) was purchased from TaKaRa (Japan), Bacterial DNA and Gel Extraction Kits were purchased from OMEGA (USA), and the QIAamp PowerFecal QIAcube HT Kit was from QIAGEN (Germany).
Instruments: The LightCycler96 fluorescence quantitative polymerase chain reaction (PCR) instrument was purchased from Roche (Switzerland), the QIAcune HT automatic nucleic acid extraction system was purchased from QIAGEN (Germany), and the Nanodrop-2000 ultramicro nucleic acid protein analyzer was from Thermo Fisher (USA).
Primer and TaqMan probe sequences used in this study.
Pathogen | Target gene | Accession number | Primer (position) | Sequence (5’ → 3’) | Amplicon length (bp) |
---|---|---|---|---|---|
CP044134.1 | 64F | ACTACCCATCAGATTATGTCAT | 101 | ||
165R | CTGTTTGAGGAAAATGCAATTTA | ||||
136P | FAM-ATTCACACCCTACCCAACATTCAT-BHQ1 | ||||
D37831.1 | 503F | TCGTAAAGAGCCTGAATTAA | 229 | ||
732R | ATCACCACTACCGGTTTTATC | ||||
532P | HEX-TCATGGTGATCCTCGTGATACTA-BHQ1 |
Detection limits of
The FAM channel was used to detect
Detection limits of
The FAM channel was used to detect
Detection limits of
The FAM channel was used to detect
An increasing number of diseases and public health events are caused by food-borne pathogens, to which society attaches great importance. As
TaqMan Real-Time PCR is a rapid, sensitive, specific, and efficient detection method that is widely used in food hygiene inspection, pathogen detection, and high throughput analysis (Kralik et al. 2017). In the detection of complex samples, obtaining high-quality DNA is essential to ensure the accuracy of detection (Cremonesi et al. 2014). During the analysis process, proven automated nucleic acid extraction technology and the supporting genome extraction kit are used to extract the genome in contaminated food samples to reduce the influence of human-related factors as much as possible and ensure the reliability and repeatability of genome extraction.
Target genes, primers, and probes are the decisive factors that ensure the detection method’s specificity and sensitivity. The
This method can identify and distinguish between
To conclude, we have created a practical, easy-to-use, and highly efficient method based on TaqMan Real-Time PCR for the identification and classification of