Uneingeschränkter Zugang

Establishment and Application of a Dual TaqMan Real-Time PCR Method for Proteus Mirabilis and Proteus Vulgaris


Zitieren

Introduction

Bacterial food-borne diseases are an increasing public health concern to the World Health Organization (Johnson 2011). The consumption of food and drinking water contaminated by pathogenic bacteria is the leading cause of food-borne disease outbreaks (Park et al. 2011). More than 250 types of foodborne diseases caused by the pathogen with various virulence genes have been identified (Mangal et al. 2016). In recent years, the number of food-borne diseases caused by Proteus, including vomiting, gastroenteritis, and acute diarrhea, has been increasing.

Proteus species are Gram-negative bacteria belonging to the Morganellaceae family that widely exist in nature (Adeolu et al. 2016; Drzewiecka 2016). The genus mainly includes Proteus mirabilis, Proteus vulgaris, Proteus penneri, Proteus hauseri, Proteus terrae, Proteus cibarius, unnamed geomospecies 4, 5, and 6 (Behrendt et al. 2015, Gu et al. 2020). P. mirabilis and P. vulgaris are the most well-known species in the genus Proteus, and they carry several virulence factors that contribute to gastrointestinal (GI) pathogenesis, such as LPS, hemolysin, and O-antigen (Drzewiecka 2016; Hamilton et al. 2018). Because people living in developed countries generally have access to improved sanitation, food poisoning caused by Proteus is less common. However, researchers from developed countries also recently noted that Proteus strains are closely associated with GI diseases. Hamilton and coworkers (Hamilton et al. 2018) revealed that P. mirabilis and P. vulgaris were essential for the pathogenesis of infections in the GI tract and called on other researchers to pay closer attention to the role of these two species. In developing countries that are highly populated (e.g., China), Proteus species are among the leading bacterial causes of food poisoning. In 1996, the Ministry of Health of the People’s Republic of China issued the WS/T 9-1996: Diagnostic Criteria and Principles of Management for Food Poisoning of Proteus, which remains in effect. The document explicitly states that Proteus can easily contaminate animal food, and therefore, inspections for animal food safety should include the identification and classification of Proteus strains. In 2008, Beijing reported a case of collective food poisoning caused by P. mirabilis, in which 13 individuals displayed symptoms related to food poisoning, including fever, vomiting, and diarrhea (Wang et al. 2010). China recorded 2,795 foodborne illness outbreaks between 2003 and 2008; in particular, there were 110 (3.93%) public health crises caused by Proteus species as foodborne pathogens, resulting in 3,093 individuals to have symptoms of food poisoning (Wu et al. 2018).

In developed countries, researchers generally do not consider Proteus as a foodborne pathogen, and thus, they pay little attention to the identification of Proteus in food. Surprisingly, no study has reported the use of quantitative fluorescence PCR (Q-PCR) to identify P. vulgaris even though the technique has already been applied to the detection of P. mirabilis (Liu et al. 2019). At present, 16S ribosomal RNA (rRNA) sequencing, selective media, biochemical identification, and serological tests remain the mainstay modalities for distinguishing between strains of P. mirabilis and P. vulgaris (O’Hara et al. 2000). In this study, we used a dual TaqMan Real-Time PCR for the rapid and accurate identification and classification of P. mirabilis and P. vulgaris in food samples.

Experimental
Materials and Methods

Reagents, instruments and bacterial strains. Bacterial strains: thirty-six strains, including eight strains of P. mirabilis (four standard strains, and four clinical isolates), seven strains of P. vulgaris (four standard strains, and three clinical isolates) and 21 other strains (Table I), were used in this study. Bacteria were cultured according to Bergey’s Manual of Systematic Bacteriology (9th edition) (Garrity et al. 2004).

Bacterial strains used in the specificity assessment.

StrainOriginFAMHEX
Proteus mirabilisCVCC4106+
Proteus mirabilisCVCC1969+
Proteus mirabilisATCC35659+
Proteus mirabilisCMCC49001+
Proteus mirabilisIsolated by lab+
Proteus mirabilisIsolated by lab+
Proteus mirabilisIsolated by lab+
Proteus mirabilisIsolated by lab+
Proteus vulgarisATCC6896+
Proteus vulgarisCMCC 49008+
Proteus vulgarisCMCC49027+
Proteus vulgarisCMCC 49105+
Proteus vulgarisIsolated by lab+
Proteus vulgarisIsolated by lab+
Proteus vulgarisIsolated by lab+
Proteus penneriATCC 33519
Proteus penneriNTCC 35198
Providencia rettgeriATCC 31052
Providencia rettgeriCVCC3947
Morganella morganiiATCC9237
Morganella morganiiCICC71786
SalmonellaATCC14028
SalmonellaCVCC2227
SalmonellaIsolated by lab
SalmonellaIsolated by lab
Escherichia coliCICC52719
Escherichia coliIsolated by lab
Escherichia coliIsolated by lab
Staphylococcus aureusATCC25923
Staphylococcus aureusIsolated by lab
Campylobacter jejuniCICC 22936
Campylobacter jejuniIsolated by lab
Mannheimia haemolyticaATCC29695
Pseudomonas aeruginosaIsolated by lab
Lactobacillus acidophilusCICC6074
Bacillus subtilisCICC20445

ATCC – American Type Culture Collection; CICC – China Center of Industrial Culture Collection; CMCC – China Medical Culture Collection; CVCC – China Veterinary Culture Collection Center, NTCC – National Type Culture Collection, China

Reagents: The Premix Ex TaqTM (Probe qPCR) was purchased from TaKaRa (Japan), Bacterial DNA and Gel Extraction Kits were purchased from OMEGA (USA), and the QIAamp PowerFecal QIAcube HT Kit was from QIAGEN (Germany).

Instruments: The LightCycler96 fluorescence quantitative polymerase chain reaction (PCR) instrument was purchased from Roche (Switzerland), the QIAcune HT automatic nucleic acid extraction system was purchased from QIAGEN (Germany), and the Nanodrop-2000 ultramicro nucleic acid protein analyzer was from Thermo Fisher (USA).

Target genes, primers, and probes. We analyzed the gene sequences of Proteus species published in GeneBank, compared the nucleotide sequences of the 16s rRNA, tuf, rpoB, atpD, ureR, blaA, and blaB genes, and the ureR and blaB were selected as the target genes for the test. Primer Premier 6.0 (Premier Biosoft, CA, USA) was used to design two pairs of primers and two probes, and all primers were compared and analyzed by BLAST to ensure their specificity. The primers and probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd., and the nucleotide sequences are shown in Table II.

Primer and TaqMan probe sequences used in this study.

PathogenTarget geneAccession numberPrimer (position)Sequence (5’ → 3’)Amplicon length (bp)
Proteus mirabilisureRCP044134.1  64FACTACCCATCAGATTATGTCAT101
165RCTGTTTGAGGAAAATGCAATTTA
136PFAM-ATTCACACCCTACCCAACATTCAT-BHQ1
Proteus vulgarisblaBD37831.1503FTCGTAAAGAGCCTGAATTAA229
732RATCACCACTACCGGTTTTATC
532PHEX-TCATGGTGATCCTCGTGATACTA-BHQ1

Genomic DNA extraction. The Bacterial DNA Kit was used to extract DNA from fresh bacterial culture medium (24 h). The QIAamp PowerFecal QIAcube HT Kit was used to extract bacterial DNA from meat and milk according to the manufacturer’s instructions. The purity and concentration of template DNA were detected using a Nanodrop-2000.

Preparation of the standard plasmid. The target fragment was amplified from P. mirabilis and P. vulgaris by PCR (PCR primers are shown in Table II), purified using the Gel Extraction Kit, and cloned into a PMD19-T vector (TaKaRa, Japan), which was then transformed into Escherichia coli DH5α. After transformation, E. coli DH5α were cultured for 18–24 h with shaking (37°C, 120 rpm), and the plasmid was extracted using a Plasmid Mini Kit. The purity and concentration of the extracted plasmid were examined using a Nanodrop-2000, and the copy number of the plasmid in a 1 μl of aliquots was converted, according to the Avogadro constant.

Specificity test. Thirty-six strains of bacteria were used to evaluate the specificity using the method. Components of the 25-μl-reaction system included 12.5 μl PCR Mix, four primers (0.5 μl for each, a total of 2 μl), two probes (0.5 μl for each, a total of 1 μl), 1 μl genome template and 8.5 μl aseptic deionized water. The reaction procedure was as follows: initially denatured at 95°C for 30 s, denatured at 95°C for 5 s, annealed at 56°C for 10 s, and extended at 72°C for 20 s. Fluorescence from both the FAM and HEX channels was measured for 40 cycles. The reagent kit used was Premix Ex TaqTM, and the equipment model was LightCycler96.

Standard curve. The two-plasmid samples were diluted ten times with ultra-pure water in a gradient manner. The fluorescence quantitative PCR reaction was performed for the optimized system. The standard curve of the relationship between the plasmid copy number and cycle threshold (Ct) was established. Repeatability assessment. The plasmid mixture containing the ureR and blaB genes was tested, and 15 repeated tests were conducted on the same sample in the same experiment to determine the coefficients of variation of Ct values and examine the reproducibility of the method.

Evaluation of detection limits for P. mirabilis and P. vulgaris.P. mirabilis and P. vulgaris in the logarithmic growth phase were diluted 10-fold continuously with aseptic saline (0.9%, NaCl) and inoculated on tryptic soy agar plates (three parallel controls were prepared). The number of colony-forming units (CFU)/ml was determined by plate counting. Then, the genomic DNA was extracted using a Bacterial DNA Kit, and absolute quantitative Real-Time PCR was performed.

Detection of P. mirabilis and P. vulgaris in contaminated meat and milk. Sterile saline (0.9%, NaCl) was used to prepare 10-fold gradient dilutions of P. mirabilis and P. vulgaris cultures, and the concentration of bacteria was determined by the plate counting method. Two bacterial suspensions were diluted to generate six gradient concentrations (102–107 CFU/ml), mixed in an isovolumetric manner, and added to a 1.5 ml sterile centrifuge tube for centrifugation at 10,000 × g for 10 min. The supernatant was removed to collect the bacteria. Fresh pork (200 g, treated with a tissue homogenizer) with quarantine approval and a carton of germ-free milk (255 ml) were purchased from the market. Then, food samples were separately mixed with the bacteria in the different centrifuge tubes. The concentration gradients of P. mirabilis and P. vulgaris in food were in the range of 102–107 CFU/g. Then, the QIAamp PowerFecal DNA Kit was used to extract the total genome from the sample for quantitative Real-Time PCR.

Results

Genomic DNA extraction. The Bacterial DNA Kit was used to extract the genomic DNA from pure cultures of 36 strains of bacteria. The concentration of the genomic DNA was in the range of 78–205 ng/μl, and the OD 260/280 was in the range of 1.81–1.92. The QIAamp PowerFecal QIAcube HT Kit was used to extract the total genomic DNA from the pork and milk contaminated by the mixed bacterial solution. In pork and milk, the total genomic DNA concentrations were in the range of 280–325 ng/μl and 94–154 ng/μl, and the OD260/280 values were 1.92–1.99 and 1.83–1.95, respectively.

Test’s specificity. The test’s specificity results are listed in Table I. Eight P. mirabilis strains exhibited a typical ‘S’ amplification curve in the FAM channel, while the other strains showed no typical amplification curve. In addition, seven P. vulgaris strains showed a typical ‘S’ amplification curve in the HEX channel, while the other strains exhibited no typical amplification curve. Together, these results show that the established method has high specificity.

Standard curve. The standard curve was established, and the plasmid copy number of different concentrations was the x-coordinate, and the corresponding Ct value was the y-coordinate. In the FAM channel, the standard curve for the P. mirabilis ureR gene (8.17 × 10 – 8.17 × 106 copies/μl) is shown in Fig. 1. The slope = 3.7136, intercept = 40.38, R2 = 1, and the linear equation was as follows: Ct = –3.7136IgX + 40.38. In the HEX channel, the standard curve for the P. vulgaris blaB gene (9.93 × 10 – 9.93 × 106 copies/μl) is shown in Fig. 2. The slope = –4.0846, intercept = 38.09, R2 = 1, and the linear equation was as follows: Ct = –4.0846IgX + 38.09.

Fig. 1.

P. mirabilis standard curve (Note: log = 1og10).

Fig. 2.

P. vulgaris standard curve (Note: log = 1og10).

Repeatability assessment. In the same experiment, 15 repeated tests were conducted using the same mixed plasmid sample (ureR = 8.17 × 104 copies/μl, blaB = 9.93 × 104 copies/μl). The results showed that when the ureR gene of P. mirabilis in the FAM channel was tested 15 times, the Ct value was 23.52 ± 0.091, and the coefficient of variation was 0.38%. When the blaB gene of P. vulgaris in the HEX channel was tested 15 times, the Ct value was 20.30 ± 0.116, and the coefficient of variation was 0.57%. These results showed that the method established in these experiments exhibited good reproducibility for the detection of P. mirabilis and P. vulgaris.

Detection limits. Seven concentrations of P. mirabilis and P. vulgaris were tested (the genomes were extracted for each concentration after isovolumetric mixing). The corresponding concentrations of P. mirabilis were 6.08 × 10 – 6.08 × 107 CFU/ml, and the concentration of P. vulgaris was 4.46 × 10 – 4.46 × 107 CFU/ml. As shown in Fig. 3, when the concentration of P. mirabilis was ≥ 6.08 × 102 CFU/ml, the typical ‘S’ amplification curve was obtained. Additionally, when the concentration of P. vulgaris was ≥ 4.46 × 102 CFU/ml, the typical ‘S’ amplification curve was obtained. The results showed that the lowest detection limits of P. mirabilis and P. vulgaris were 6.08 × 102 CFU/ml and 4.46 × 102 CFU/ml, respectively.

Fig. 3.

Detection limits of P. mirabilis and P. vulgaris in a Dual TaqMan Real-Time PCR Method.

The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 6.08 × 107 – 6.08 × 102 CFU/ml. When the concentration of P. mirabilis was 6.08 × 10 CFU/ml, no amplification curve was obtained. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 4.46 × 107 – 4.46 × 102 CFU/ml. When the concentration of P. vulgaris was 4.46 × 10 CFU/ml, no amplification curve was obtained.

Detection of the bacteria in contaminated meat and milk. The use of this method to detect food contamination was evaluated by testing pork and milk contaminated by P. mirabilis and P. vulgaris. The results showed that P. mirabilis and P. vulgaris in pork or milk could be detected when their content was ≥ 103 CFU/g (Fig. 4 and 5).

Fig. 4.

Detection limits of P. mirabilis and P. vulgaris in contaminated pork.

The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Fig. 5.

Detection limits of P. mirabilis and P. vulgaris in contaminated milk.

The FAM channel was used to detect P. mirabilis, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g. The HEX channel was used to detect P. vulgaris, and the concentration of the ‘S’ amplification curve from left to right was in the range of 107 – 103 CFU/g.

Discussion

An increasing number of diseases and public health events are caused by food-borne pathogens, to which society attaches great importance. As Proteus is not a common cause of food poisoning in developed countries, researchers in these countries may not believe that Proteus can cause foodborne illness. Conversely, Proteus is an important foodborne pathogen in countries with developing economies. Proteus species are most commonly found in the human intestinal tract. Because they comprise less than 0.05% of the human microbiome (Yatsunenko et al. 2012), their presence can be easily overlooked. It has been demonstrated that unclean hands may have an important role in the hand-to-mouth spread of Proteus species. Smith et al. (2009) found strains of P. vulgaris on the handsets of telephone booths in Nigeria. Padaruth et al. (2014) reported that Proteus species were present on the hands of primary school students in Mauritius. Qadripur et al. (2001) identified P. mirabilis colonization on painters’ hands. In developed countries, people usually maintain daily cleanliness by practicing good sanitary habits; contrarily, people living in developing countries are less aware of personal hygiene’s importance. It is a major reason why Proteus is a much higher public health concern in underdeveloped countries.

TaqMan Real-Time PCR is a rapid, sensitive, specific, and efficient detection method that is widely used in food hygiene inspection, pathogen detection, and high throughput analysis (Kralik et al. 2017). In the detection of complex samples, obtaining high-quality DNA is essential to ensure the accuracy of detection (Cremonesi et al. 2014). During the analysis process, proven automated nucleic acid extraction technology and the supporting genome extraction kit are used to extract the genome in contaminated food samples to reduce the influence of human-related factors as much as possible and ensure the reliability and repeatability of genome extraction.

Target genes, primers, and probes are the decisive factors that ensure the detection method’s specificity and sensitivity. The ureR gene is a urease gene regulator and an essential virulence factor for the genus Proteus. Researchers have already confirmed the activity of urease in P. mirabilis, P. vulgaris, and P. penneri, which allows these species to quickly adapt to the digestive tract and grow rapidly in an environment at pH of 5–10 (Mobley et al. 1987, 1991). It makes the ureR gene one of the most widely accepted target genes for detecting and identifying P. mirabilis (Liu et al. 2019; Wang et al. 2019). We believe that the β-lactamase gene blaB exists in the genome of P. vulgaris. Matsubara et al. (1981) reported that P. vulgaris strains were mostly resistant to β-lactam antibiotics. Aspiotis and coworkers (Aspiotis et al. 1986) found that the resistance to β-lactam antibiotics was facilitated by the presence of β-lactamase in P. vulgaris, and even strains sensitive to β-lactam antibiotics could produce low levels of β-lactamase. Ishiguro and coworkers (Ishiguro et al. 1996) found that the production of β-lactamase in P. vulgaris was regulated by the blaB and blaA genes, making them the essential genes for β-lactamase production. The studies mentioned above provided ample evidence that blaB is extensively present in P. vulgaris. To verify this viewpoint, we analyzed 12 whole-genomes of P. vulgaris obtained from GenBank. As a result, the blaB gene was found in every genome. On this basis, we used ureR and blaB as the target genes for detection. Primers and probes were designed according to the conserved sequences of the two genes. The nucleotide sequences of the primers and probes were compared using NCBI BLAST. The primers and probes were able to identify target locations for PCR amplification in P. mirabilis and P. vulgaris.

This method can identify and distinguish between P. mirabilis and P. vulgaris efficiently and accurately. At present, 16S rRNA sequencing, selective media, biochemical identification, and serological tests are the major methods for identifying and classifying Proteus species (O’Hara et al. 2000). However, these methods are complex, and they require more than 24 h to complete all procedures. Against this backdrop, we developed a timesaving method that enables species identification and classification within two hours. As food poisoning is largely an emergency, quick identifying of the pathogen can facilitate the development of a suitable treatment plan. Additionally, our method also displays a high degree of sensitivity. Wang et al. (2019) developed a multiplex PCR-based method to classify six different pathogenic bacteria, and the minimum detectable concentration of P. mirabilis was 8.6 × 103 CFU/ml. Compared with multiplex PCR, Q-PCR is substantially more sensitive. Liu et al. (2019) used Q-PCR to detect 12 foodborne pathogenic bacteria under the same reaction condition, and the minimum detectable concentration of P. mirabilis in the pork samples was 1 × 104 CFU/g. When using this method, researchers should assure that the reaction condition meets the requirements for PCR amplification of all bacteria. However, this does not necessarily mean that the reaction provides the best condition for the TaqMan Real-Time PCR amplification of P. mirabilis. Compared with the method introduced by Liu et al. (2019), our design has a higher degree of sensitivity. For contaminated pork and milk, the minimum detectable concentrations of P. mirabilis and P. vulgaris were both 1 × 103 CFU/g, indicating an advancement in the identification and classification of Proteus species.

To conclude, we have created a practical, easy-to-use, and highly efficient method based on TaqMan Real-Time PCR for the identification and classification of P. mirabilis and P. vulgaris in food that can be widely used in food safety and inspection service.

eISSN:
2544-4646
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Mikrobiologie und Virologie