<abstract xmlns="http://www.w3.org/1999/xhtml">

<p>Abortion in small ruminants is a significant problem in Iraq and causes severe economic losses in sheep farms. <italic>Chlamydia abortus</italic> causes enzootic abortion in ewes and is associated with reproductive problems in sheep in Sulaimani province – Northern Iraq. During a lambing season in 2017, abortion was widespread among several sheep flocks in different regions of Sulaimani (Kalar, Said Sadiq, and Chamchamal), and <italic>C. abortus</italic> was one of the causes. Accordingly, we carried out this study to isolate and identify <italic>C. abortus</italic> in aborted ewes in these regions. We collected 30 samples of aborted fetuses from five herds in which abortions had been observed. The pathogen isolation was done by inoculation into embryonated chicken eggs and conventional PCR was used to identify <italic>C. abortus</italic> in clinical specimens. <italic>C. abortus</italic> was identified in one of the 30 aborted fetuses (3.33%) from the Kalar district, and all the remaining 29 samples (96.66%) were found positive to <italic>Brucella abortus</italic>. The gene <italic>ompA</italic> encoding the outer membrane protein of <italic>C. abortus</italic> was sequenced and got the accession number MK643153 in NCBI GenBank. The sequence was named <italic>C. abortus</italic> strain Sul/2017. Our isolate showed 99.79% homology with Sul/014 (accession No. KY399850) and differed from the latter by two amino acid substitutions at E115K and K259N. The topology of the phylogenetic tree based on the <italic>ompA</italic> gene showed that the isolate belongs to <italic>C. abortus</italic> and has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243, respectively.</p>
</abstract>

Abortion in small ruminants is a significant problem in Iraq and causes severe economic losses in sheep farms. Chlamydia abortus causes enzootic abortion in ewes and is associated with reproductive problems in sheep in Sulaimani province – Northern Iraq. During a lambing season in 2017, abortion was widespread among several sheep flocks in different regions of Sulaimani (Kalar, Said Sadiq, and Chamchamal), and C. abortus was one of the causes. Accordingly, we carried out this study to isolate and identify C. abortus in aborted ewes in these regions. We collected 30 samples of aborted fetuses from five herds in which abortions had been observed. The pathogen isolation was done by inoculation into embryonated chicken eggs and conventional PCR was used to identify C. abortus in clinical specimens. C. abortus was identified in one of the 30 aborted fetuses (3.33%) from the Kalar district, and all the remaining 29 samples (96.66%) were found positive to Brucella abortus. The gene ompA encoding the outer membrane protein of C. abortus was sequenced and got the accession number MK643153 in NCBI GenBank. The sequence was named C. abortus strain Sul/2017. Our isolate showed 99.79% homology with Sul/014 (accession No. KY399850) and differed from the latter by two amino acid substitutions at E115K and K259N. The topology of the phylogenetic tree based on the ompA gene showed that the isolate belongs to C. abortus and has a common ancestor with isolates of sheep in Iraq and Tunisia with accession numbers KY399850 and HQ62243, respectively.

Isolation and Identification of <italic>Chlamydia abortus</italic> from Aborted Ewes in Sulaimani Province, Northern Iraq

Polish Journal of Microbiology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Isolation and Identification of  from Aborted Ewes in Sulaimani Province, Northern Iraq

Abortion in small ruminants is a significant problem in Iraq and causes severe economic losses in sheep farms. Chlamydia abortus causes enzootic abortion in...

Name of district	Number of samples collected	Number positive for C. abortus (%)	Number positive for B. abortus (%)
Kalar	15	1 (6.66)	14 (93.33)
Said Sadiq	10	0	10 (100)
Chamchamal	5	0	5(100)
Total	30	1 (3.33)	29 (96.66)

Target gene	Primer name	Primer sequence (5′–3′)	Amplified fragment length (bp)	Reference
ompA	omp-F	ATGAAAAAACTCTTGAAATCGG	1058	Arshi et al. 2011
ompA	omp-R	CAAGATTTTCTAGACTTCATTTTGTT	1058	Arshi et al. 2011
bcsp31	B4-F	TGGCTCGGTTGCCAATATCAA	223	Baily et al. 1992
bcsp31	B5-R	CGCGCTTGCCTTTCAGGTCTG	223	Baily et al. 1992

Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq

Article Category: original-paper

Data publikacji: 28 lut 2020

Zakres stron: 65 - 71

Otrzymano: 11 gru 2019

Przyjęty: 30 sty 2020

DOI: https://doi.org/10.33073/pjm-2020-009

Słowa kluczowe
enzootic abortion in ewes, embryonated egg, polymerase chain reaction

© 2020 Eman Dhahir Arif et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Detection of Chlamydia abortus and Brucella abortus in different herds of sheep from three districts in Sulaimani province by PCR.

The targeted genes and PCR primers used for the detection of Chlamydia abortus and Brucella abortus in aborted ewes.

Isolation and Identification of Chlamydia abortus from Aborted Ewes in Sulaimani Province, Northern Iraq

Article Category: original-paper

Data publikacji: 28 lut 2020

Zakres stron: 65 - 71

Otrzymano: 11 gru 2019

Przyjęty: 30 sty 2020

DOI: https://doi.org/10.33073/pjm-2020-009

Słowa kluczoweenzootic abortion in ewes, embryonated egg, polymerase chain reaction

© 2020 Eman Dhahir Arif et al., published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Fig. 1.

Fig. 2.

Fig. 3.

Detection of Chlamydia abortus and Brucella abortus in different herds of sheep from three districts in Sulaimani province by PCR.

The targeted genes and PCR primers used for the detection of Chlamydia abortus and Brucella abortus in aborted ewes.

Słowa kluczowe
enzootic abortion in ewes, embryonated egg, polymerase chain reaction