IFNγ production profile in turkeys of different immunological status after TRT vaccination
, , , oraz
16 cze 2020
O artykule
Data publikacji: 16 cze 2020
Zakres stron: 239 - 245
Otrzymano: 03 mar 2020
Przyjęty: 18 maj 2020
DOI: https://doi.org/10.2478/jvetres-2020-0040
Słowa kluczowe
© 2020 M. Śmiałek et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1

Fig. 2

Mean percentage of CD8+ IFNγ+ cells ± SD within splenic mononuclear cells of turkeys of vaccinated (V) and not vaccinated (NV) groups of experiments I–IV at different DPV
Mean percentage of CD8+IFNγ+ cells ± SD | ||||
---|---|---|---|---|
Experiment | Group | 3 DPV | 7 DPV | 10 DPV |
I | MDA+0/V | 1.14 ± 0.56 | 1.4 ± 0.36 | 5.45 ± 2.21* |
MDA+0/NV | 0.64 ± 0.11 | 1.48 ± 0.8 | 1.21 ± 0.46 | |
II | MDA−0/V | 2.82 ± 1.67* | 1.37 ± 0.83 | 1.17 ± 0.15 |
MDA−0/NV | 0.5 ± 0.35 | 0.39 ± 0.02 | 1.08 ± 0.18 | |
III | MDA+14/V | 4.26 ± 1.96 | 3.57 ± 0.42 | 3.69 ± 1.46* |
MDA+14/NV | 1.55 ± 0.73 | 2.81 ± 0.83 | 1.39 ± 0.42 | |
IV | MDA−14/V | 1.65 ± 0.11 | 2.79 ± 1.23 | 1.55 ± 0.89 |
MDA−14/NV | 0.91 ± 0.16 | 2.01 ± 0.63 | 1.32 ± 0.78 |
Serum maternally derived anti-aMPV IgY antibody levels on the days of aMPV/A vaccination of turkeys in experiments I–IV
Bird MDA status | Mean MDA S/P ratio ± SD at the time of vaccination | |
---|---|---|
0 DOL | 14 DOL | |
MDA+ | 6.63 ± 2.53 | 2.30 ± 1.22 |
(experiment I) | (experiment III) | |
MDA− | 0.00 ± 0.00 | 0.00 ± 0.00 |
(experiment II) | (experiment IV) |
Mean percentage of CD4+ IFNγ+ cells ± SD within splenic mononuclear cells of turkeys of vaccinated (V) and not vaccinated (NV) groups of experiments I–IV at different DPV
Experiment | Group | Mean percentage of CD4+IFNγ+ cells ± SD | ||
---|---|---|---|---|
3 DPV | 7 DPV | 10 DPV | ||
I | MDA+0/V | 1.11 ± 0.33 | 2.66 ± 0.97* | 3.34 ± 1.55* |
MDA+0/NV | 1.26 ± 0.67 | 0.91 ± 0.32 | 0.97 ± 0.18 | |
II | MDA−0/V | 2.27 ± 0.72* | 1.65 ± 1.08 | 1.01 ± 0.39 |
MDA−0/NV | 0.94 ± 0.32 | 0.39 ± 0.11 | 0.79 ± 0.40 | |
III | MDA+14/V | 5.21 ± 2.56* | 4.69 ± 3.69 | 4.21 ± 1.89* |
MDA+14/NV | 1.50 ± 0.01 | 1.32 ± 0.59 | 1.16 ± 0.91 | |
IV | MDA−14/V | 1.68 ± 0.20* | 2.71 ± 1.90 | 1.60 ± 0.52 |
MDA−14/NV | 0.46 ± 0.28 | 1.28 ± 0.30 | 0.50 ± 0.33 |
Primers used for real time PCR
Primer | Sequence 5”–3” | Fragment size (bp) | GenBank accession no. |
---|---|---|---|
INFγ F | CTGACAAGTCAAAGCCGCAC | ||
137 | XM_003202048.3 | ||
INFγ R | AGTCATTCATCTGAAGCTTGGC | ||
GAPDH F | CCCTGAGCTCAATGGGAAGC | ||
125 | NM_001303179.1 | ||
GAPDH R | TCAGCAGCAGCCTTCACTAC |