Cite

Fig. 1

Summary of mean relative IFNγ gene expression in splenic mononuclear cells on different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B). The relative expression of the IFNγ gene was calculated using the 2−ΔΔCt method normalised to efficiency corrections, expression levels of the reference gene coding GAPDH and adequate control groups. Bars represent mean IFN gamma expression level against its expression in the adequate control group * Significant differences at different DPV (t-test, P < 0.05)
Summary of mean relative IFNγ gene expression in splenic mononuclear cells on different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B). The relative expression of the IFNγ gene was calculated using the 2−ΔΔCt method normalised to efficiency corrections, expression levels of the reference gene coding GAPDH and adequate control groups. Bars represent mean IFN gamma expression level against its expression in the adequate control group * Significant differences at different DPV (t-test, P < 0.05)

Fig. 2

Summary of mean contribution of anti-aMPV IFNγ-secreting cells within splenic mononuclear cells at different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B) in relation to the mean contribution of anti-aMPV IFNγ-secreting cells in the spleen of adequate control birds (not vaccinated)* Significant differences in vaccinated groups of birds in comparison to adequate control groups, at different DPV (t-test, P < 0.05)
Summary of mean contribution of anti-aMPV IFNγ-secreting cells within splenic mononuclear cells at different days post aMPV/A vaccination in experiments I (MDA+ vaccinated) and II (MDA− vaccinated) (A) and III (MDA+ vaccinated) and IV (MDA− vaccinated) (B) in relation to the mean contribution of anti-aMPV IFNγ-secreting cells in the spleen of adequate control birds (not vaccinated)* Significant differences in vaccinated groups of birds in comparison to adequate control groups, at different DPV (t-test, P < 0.05)

Mean percentage of CD8+ IFNγ+ cells ± SD within splenic mononuclear cells of turkeys of vaccinated (V) and not vaccinated (NV) groups of experiments I–IV at different DPV

Mean percentage of CD8+IFNγ+ cells ± SD
ExperimentGroup3 DPV7 DPV10 DPV
IMDA+0/V1.14 ± 0.561.4 ± 0.365.45 ± 2.21*
MDA+0/NV0.64 ± 0.111.48 ± 0.81.21 ± 0.46
IIMDA−0/V2.82 ± 1.67*1.37 ± 0.831.17 ± 0.15
MDA−0/NV0.5 ± 0.350.39 ± 0.021.08 ± 0.18
IIIMDA+14/V4.26 ± 1.963.57 ± 0.423.69 ± 1.46*
MDA+14/NV1.55 ± 0.732.81 ± 0.831.39 ± 0.42
IVMDA−14/V1.65 ± 0.112.79 ± 1.231.55 ± 0.89
MDA−14/NV0.91 ± 0.162.01 ± 0.631.32 ± 0.78

Serum maternally derived anti-aMPV IgY antibody levels on the days of aMPV/A vaccination of turkeys in experiments I–IV

Bird MDA statusMean MDA S/P ratio ± SD at the time of vaccination
0 DOL14 DOL
MDA+6.63 ± 2.532.30 ± 1.22
(experiment I)(experiment III)
MDA−0.00 ± 0.000.00 ± 0.00
(experiment II)(experiment IV)

Mean percentage of CD4+ IFNγ+ cells ± SD within splenic mononuclear cells of turkeys of vaccinated (V) and not vaccinated (NV) groups of experiments I–IV at different DPV

ExperimentGroupMean percentage of CD4+IFNγ+ cells ± SD
3 DPV7 DPV10 DPV
IMDA+0/V1.11 ± 0.332.66 ± 0.97*3.34 ± 1.55*
MDA+0/NV1.26 ± 0.670.91 ± 0.320.97 ± 0.18
IIMDA−0/V2.27 ± 0.72*1.65 ± 1.081.01 ± 0.39
MDA−0/NV0.94 ± 0.320.39 ± 0.110.79 ± 0.40
IIIMDA+14/V5.21 ± 2.56*4.69 ± 3.694.21 ± 1.89*
MDA+14/NV1.50 ± 0.011.32 ± 0.591.16 ± 0.91
IVMDA−14/V1.68 ± 0.20*2.71 ± 1.901.60 ± 0.52
MDA−14/NV0.46 ± 0.281.28 ± 0.300.50 ± 0.33

Primers used for real time PCR

PrimerSequence 5”–3”Fragment size (bp)GenBank accession no.
INFγ FCTGACAAGTCAAAGCCGCAC
137XM_003202048.3
INFγ RAGTCATTCATCTGAAGCTTGGC
GAPDH FCCCTGAGCTCAATGGGAAGC
125NM_001303179.1
GAPDH RTCAGCAGCAGCCTTCACTAC
eISSN:
2450-8608
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Life Sciences, Molecular Biology, Microbiology and Virology, other, Medicine, Veterinary Medicine