Otwarty dostęp

Effect of Vicia sativa L. on Motility, Mortality and Expression Levels of hsp Genes in J2 Stage of Meloidogyne hapla

Renata Dobosz
Renata Dobosz
, 
Łukasz Flis
Łukasz Flis
, 
Jan Bocianowski
Jan Bocianowski
 oraz 
Tadeusz Malewski
Tadeusz Malewski
   | 14 kwi 2023
Journal of Nematology's Cover Image
O artykule
Poprzedni artykuł
Następny artykuł
Zacytuj
Article Category: Research paper
Data publikacji: 14 kwi 2023
Zakres stron: -
Otrzymano: 09 maj 2022
DOI: https://doi.org/10.2478/jofnem-2023-0009
Słowa kluczowe
© 2023 Dobosz et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1

Dendrogram of the nearest neighbour cluster grouping of combinations of temperature, cultivars, and variants on the basis of four traits.
Dendrogram of the nearest neighbour cluster grouping of combinations of temperature, cultivars, and variants on the basis of four traits.

Figure 2

Distribution of 36 combinations of temperatures, cultivars, and variants in the space of the first two canonical variables.
Distribution of 36 combinations of temperatures, cultivars, and variants in the space of the first two canonical variables.

Figure 3

Influence of Vicia sativa cv. Ina diffusate treatment on hsp gene expression in Meloidogyne hapla J2 stage. Each value represents the mean ± s.d. of three biological replicates. The expression levels are indicated as the fold-change normalized to the control (untreated diffusate), normalized to the value of 1 (dashed line). Values were expressed as the mean fold difference, and statistically significant differences between treated and control samples are shown; *p≤0.01 based on t-Student test.
Influence of Vicia sativa cv. Ina diffusate treatment on hsp gene expression in Meloidogyne hapla J2 stage. Each value represents the mean ± s.d. of three biological replicates. The expression levels are indicated as the fold-change normalized to the control (untreated diffusate), normalized to the value of 1 (dashed line). Values were expressed as the mean fold difference, and statistically significant differences between treated and control samples are shown; *p≤0.01 based on t-Student test.

Mobility of Meloidogyne hapla second-stage juveniles (J2) after exposed to water and Vicia sativa seed diffusates, and mortality after NaOH treatment. In table we presented meand values [In %] and standard deviations - s.d. [In %].

Combination Temperature Cultivar Variant Immobile J2 after 24 h Immobile J2 after 48 h Immobile J2 immersed in water Immobile J2 after NaOH treatment
Mean ± s.d. Mean ± s.d. Mean ± s.d. Mean ± s.d.
1 10°C Ina J2+H2O 0 ± 0 i 0 ± 0 k 0 ± 0g 0 ± 0 f
2 10°C Ina J2+S+H2O 34.72 ± 13.062 de 29.44 ± 12.936 hi 2.778 ± 1.297 ef 2.778 ± 1.297 de
3 10°C Ina J2+StS+H2O 43.33 ± 12.713 c 30.56 ± 15.031 ghi 1.111 ±2.171 fg 1.111 ±2.171 ef
4 10°C Ina J2+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
5 10°C Ina J2+S+RD 8.06 ± 4.597 h 22.22 ± 13.731 ij 1.389 ± 1.716 fg 1.667 ±2.247 ef
6 10°C Ina J2+StS+RD 20 ± 9.535 f 34.44 ±8.165 fgh 1.944 ± 1.716 fg 1.944 ± 1.716 ef
7 10°C Jaga J2+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
8 10°C Jaga J2+S+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
9 10°C Jaga J2+StS+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
10 10°C Jaga J2+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
11 10°C Jaga J2+S+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
12 10°C Jaga J2+StS+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
13 17°C Ina J2+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
14 17°C Ina J2+S+H2O 18.33 ± 10.2 fg 14.72 ± 19.667 j 0±0g 0 ± 0 f
15 17°C Ina J2+StS+H2O 21.94 ± 15.6 f 24.72 ± 15.793 i 4.167 ±4.949 de 4.167 ± 4.949 d
16 17°C Ina J2+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
17 17°C Ina J2+S+RD 36.39 ± 10.489 d 48.89 ± 15.33 d 0±0g 0 ± 0 f
18 17°C Ina J2+StS+ RD 36.11 ± 9.83 d 38.89 ± 14.094 efg 1.667 ±1.741 fg 1.667 ± 1.741 ef
19 17°C Jaga J2+ H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
20 17°C Jaga J2+S+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
21 17°C Jaga J2+StS+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
22 17°C Jaga J2+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
23 17°C Jaga J2+S+ RD 0 ± 0 i 45.83 ± 14.848 de 1.667 ±2.247 fg 1.667 ±2.247 ef
24 17°C Jaga J2+StS+RD 0 ± 0 i 39.17 ± 14.293 efg 0.556 ± 1.297 g 0.556 ± 1.297 f
25 21 °C Ina J2+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
26 21°C Ina J2+S+H20 17.78 ± 10.184 fg 39.72 ± 11.322 ef 7.778 ±4.103 c 7.778 ±4.103 c
27 21°C Ina J2+StS+H2O 29.44 ± 9.727 e 38.33 ± 9.924 efg 29.167 ± 10.648 a 29.167 ± 10.648 a
28 21°C Ina J2+RD 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
29 21°C Ina J2+S+RD 53.61 ± 14.387 b 71.11 ± 22.398 c 1.389 ± 1.716 fg 1.389 ± 1.716 ef
30 21°C Ina J2+StS+RD 100 ± 0 a 100 ± 0 a 0.556 ± 1.297 g 0.556 ± 1.297 f
31 21°C Jaga J2+H2O 0 ± 0 i 0 ± 0 k 0±0g 0 ± 0 f
32 21°C Jaga J2+S+H2O 14.44 ± 7.566 g 44.17 ± 15.707 de 6.944 ±3.001 cd 6.944 ± 3.001 c
33 21°C Jaga J2+StS+H2O 16.67 ±6.816 fg 15.56 ± 7.698 j 10.556 ± 7.083 b 10.556 ± 7.083 b
34 21°C Jaga J2+RD 0 ± 0 i 0 ± 0 k 0 ± 0 g 0 ± 0 f
35 21°C Jaga J2+S+RD 20.83 ± 6.376 f 100 ± 0 a 2.778 ±3.978 ef 2.778 ± 3.978 de
36 21°C Jaga J2+StS+RD 18.33 ± 8.704 fg 84.17 ± 24.168 b 1.667 ± 2.659 fg 1.667 ±2.659 ef
LSD0.05 5.39 8.795 2.171 2.18

Mean squares [%2] from three-way analysis of variance for observed traits.

Source of variation d.f. Immobile J2 after 24 h Immobile J2 after 48 h Immobile J2 immersed in water Immobile J2 after NaOH treatment
Temperature (T) 2 8723.15*** 38277.8*** 943.39*** 938.374***
Cultivar (C) 1 40703.81*** 8983.6*** 257.202*** 262.371***
Variant (V) 5 9691.42*** 34681.6*** 583.498*** 582.31***
TC 2 159.67* 3219.1*** 47.557** 47.016**
TV 10 3228.36*** 7990.8*** 440.458*** 441.152***
CV 5 5546.58*** 2276.7*** 184.671*** 183.297***
TCV 10 2071.8*** 884.7*** 104.192*** 104.979***
Residual 396 45.1 120.1 7.319 7.377

List of primers used in the study.

Primer Seq 5´ to 3´- Forward Seq 5´ to 3´ - Reverse
Mh-hsp90 TCTCTGATGATGAGGCTGAAGA TCACCGTCCTTCTTGTCCTT
Mh-hsp1 ACTCATCTTGGTGGTGAAGATT TCAATGCCATCAAAGAGAGAATCA
Mh-hsp60 TTCCTGCTCTTGAATTGGCT AATTGTGACTTCATCCGCCT
Mh-hsp43 CGTAGAGAAGAATTCCGTGAAGA TTCAGAGCGGTGACTTCCA
Mh-hsp12.3 GCCTCTCCAGCATAATGACG CGATTTATTTCACGACTGACTGA

Correlation coefficients between observed traits.

Trait Immobile J2 after 24 h Immobile J2 after 48 h Immobile J2 immersed in water Immobile J2 after NaOH treatment
Immobile J2 after 24 h 1
Iimmobile J2 after 48 h 0.7419*** 1
Immobile J2 immersed in water 0.2069 0.2241 1
Immobile treatment J2 after NaOH 0.2066 0.2241 1*** 1

Meloidogyne hapla genes homologous to Caenorhabditis elegans hsp genes (based on WormBase version: WS246).

Hsp family Gene C. elegans (Transcript ID) Gene M. hapla (Transcript ID) Gene location on contig
Hsp90 hsp90 (C47E8.5) MhA1_Contig1972.frz3.gene3 4732..7425
Hsp70 hsp1 (F26D10.3) MhA1_Contig113.frz3.gene45 79493..86067
Hsp60 hsp60 (Y22D7AL.5) MhA1_Contig737.frz3.gene23 48523..50607
sHsps hsp43 (C14F11.5) MhA1_Contig30.frz3.gene18 50262..54876
sHsps hsp12.3 (F38E11.1) MhA1_Contig199.frz3.gene23 35708..36080
eISSN:
2640-396X
Język:
Angielski
Częstotliwość wydawania:
Volume Open
Dziedziny czasopisma:
Life Sciences, other
Kanał RSS czasopisma