The small hive beetle (SHB)
Phylogenetic analysis with the use of mitochondrial DNA, due to its higher mutation rate compared with that of nuclear DNA, has been demonstrated to be useful for the identification of relationships among geographical strains and research on the origin of populations (Birky, 2001; Allio et al., 2017). Therefore, the mitochondrial cytochrome
On the other hand, parasites of honey bee were also known to indirectly affect apiculture by carrying and spreading honeybee pathogens (Forfert et al., 2015; Posada-Florez et al., 2020). Some studies have reported deformed wing virus (DWV) (Eyer et al., 2009), microsporidian
According to the present study, SHB infestation in apiaries was diagnosed and the phylogenetic relationship between South Korean SHB and those detected in other countries was investigated based on analysis of the COI gene, so that the route of invasion for this parasite in South Korea could be identified. In addition, fourteen honey bee pathogens in SHB were also detected to understand the types of honey bee pathogens that SHB are reservoirs for, in order to then determine potential honey bee diseases transmitted by SHB.
SHB were diagnosed through the direct observation of whether eggs, larvae or adults were present in honey bee hives. Samples were collected according to the standard method of Neumann et al. (2013) from infested colonies between 2016 and 2018, from four apiaries in the city of Miryang where the SHB invasion was reported for the first time in South Korea and from one apiary in Damyang County, Jeollanam Province in 2021. One hive in each apiary with SHB was selected and transported to the Parasitic and Honey Bee Disease Laboratory, Animal and Plant Quarantine Agency, South Korea. Samples were used for species identification through morphological and molecular analysis. Morphological identification of
Total nucleic acid was extracted with the use of the Maxwell® RSC viral total nucleic acid purification kit (Promega, Madison, WI, USA). Two individual adult SHB or five larvae and 600 μL of PBS solution were added in a tissue-homogenizing tube with 2.381 mm diameter steel beads (SNC, Hanam, South Korea), and homogenized with the use of a Precellys 24 tissue homogenizer (Bertin Instruments, Montigny-le-Bretonneux, France) at four 15 s cycles at 5000 rpm. Afterwards, 300 μL homogenate, 300 μL of lysis buffer, and 30 μL of proteinase K solution were added to each tube and incubated at 56°C for 10 min.
Nucleic acid was then purified automatically with the automated Maxwell® RSC instrument (Promega, Madison, WI) according to the manufacturer’s instructions. Finally, 100 μl total nucleic acid acquired from each sample was used for the detection of honey bee pathogens. To extract DNA from SHB for the amplification of the COI gene, the FastDNA Spin Kit for Soil (Santa Ana, California, USA) was used with some modifications. Two individual adult SHB or five larvae were placed in a tissue-homogenizing tube with steel beads (SNC, Hanam, South Korea). After the addition of 978 μL sodium phosphate buffer and 122 μL MT buffer from the FastDNA Spin Kit for Soil (Santa Ana, California, USA), the samples were homogenized with the use of a Precellys 24 tissue homogenizer (Bertin Instruments, Montigny-le-Bretonneux, France) at four 15 s cycles at 5000 rpm. The following steps for DNA purification were done according to the manufacturer’s instructions.
The mitochondrial COI gene of four adult samples from four different apiaries was used for molecular identification of SHB and for phylogenetic analysis. A 1091-bp DNA fragment COI was amplified with a primer pair AT1904S (5′-GGTGGATCTTCAGTTGATTTAGC-3′) and AT2953A (5′-TCAGCTGGGGGATAAAATTG-3′) (Evans et al., 2000) and AccuPower PCR PreMix (Bioneer, Daejeon, Korea). The 20 μl reaction mix was composed of 5 μl of total nucleic acid, 1 μl (10 pmol) of each primer, and 13 μl of ddH2O. PCR conditions were 95°C for 5 min followed by 35 cycles of 95°C for 30 s, 42°C for 30 s, and 72°C for 1 min, and final extension at 72°C for 5 min. After confirming the expected band in electrophoresis gel, 1.5% agarose and 1× of RedSafe™ nucleic acid staining solution (iNtRON Biotechnology, Inc., Gyeonggi-do, South Korea), the PCR products were sent to Macrogen (Seoul, South Korea) to be sequenced with the use of the Sanger sequencing method. The generated COI sequence was deposited on NCBI with accession number MZ234080. The COI sequence was compared to deposited sequences of
Fourteen prevalent honey bee pathogens were detected in the total nucleic acid extracted from four different samples of collected adult SHB to confirm whether they were carrying these honey bee pathogens. The pathogens include the following viral pathogens: DWV type A, acute bee paralysis virus (ABPV), black queen cell virus (BQCV), chronic bee paralysis virus (CBPV), Israeli acute paralysis virus (IAPV), Kashmir bee virus (KBV), sacbrood virus (SBV), three fungal pathogens (
Specific primers used for detection of honey bee pathogens
No. | Pathogen | Primer sequence (5′-3′) | Amplicon size (bp) | Annealing temp (°C) | Reference | |
---|---|---|---|---|---|---|
1 | SBV | F: ACCAACCGATTCCTCAGTAG |
487 | 57 | Grabensteiner et al., 2001 | |
2 | ABPV | F: TTATGTGTCCAGAGACTGTATCCA |
901 | 55 | Benjeddou et al., 2001 | |
3 | CBPV | F: AGTTGTCATGGTTAACAGGATACGAG |
455 | 55 | Ribiere et al., 2002 | |
4 | Virus | DWV | F: TCATCTTCAACTCGGCTTTCTACG |
479 | 62 | Lee et al., 2005a |
5 | BQCV | F: TGGTCAGCTCCCACTACCTTAAAC |
701 | 55 | Benjeddou et al., 2001 | |
6 | KBV | F: GATGAACGTCGACCTATTGA |
415 | 50 | Stoltz et al., 1995 | |
7 | IAPV | F: GATTTGAGAGATGTATTTCCTTCTGCGG |
725 | 52 | This study | |
8 | Bacteria | F: GTGTTTCCTTCGGGAGACG |
232 | 55 | Lee et al., 2004 | |
9 | F: AAGAGTAACTGTTTTCCTCG |
583 | 52 | Ha et al., 2005 | ||
10 | F: GGCTGTAGGGGGGAACCAGGA |
995 | 62 | Lee et al., 2005b | ||
11 | Fungus | F: ATCGGGCGGTGTTTCTATG |
311 | 55 | Lee et al., 2004 | |
12 | F: CTGCCTGACGTAGACGCTAT |
592 | 50 | Yoo et al., 2008 | ||
13 | Parasite | F: CAGTAGGGCTAGATATCGATACCCGAGCTT |
247 | 55 | This study | |
14 | F: GTACACCTATACATTGGGTTCGTACATTAC |
500 | 57 | This study |
Abbreviation: SBV- sacbrood virus; ABPV- acute bee paralysis virus; CBPV- chronic bee paralysis virus; DWV- deformed wing virus; BQCV- black queen cell virus; KBV- Kashmir bee virus; IAPV- Israeli acute bee paralysis virus.
SHB infestation was detected through the observation of eggs, larvae or adults deposited in the combs of honey bee hives (Fig. 1). Morphological identification of SHB was carried out by the naked eye in the apiary and then by microscopy in the laboratory. Eggs of
Infestation of small hive beetle in honeybee hives.
Identification of small hive beetle based on morphological characteristics. Appearance of adults observed with 5~7 mm × 3~5 mm (length × width) of body size, dark brown colour, one pair of clubbed antennae on the head, and body shape of oval and dorsoventrally flattened (A). The larvae were characterized by three pairs of legs located close to the head, two rows of dorsal spines, two larger paired spines on the posterior segment of the dorsum, and body size was around 10 mm in length (B-D). Eggs of SHB were seen in capped bee brood with pearly-white colour and size of around 1.4 mm × 0.26 mm (length × width) (E and F).
The COI gene of SHB collected from different apiaries in Miryang and Damyang, South Korea were 100% identitical to one another. These generated sequences also were 100% identical to reported COI sequences of SHB originating from the USA (NCBI accession no.: KC966652) and South Korea (MN023006). Phylogenetic analysis was conducted to identify the relationships among South Korean haplotypes and reported SHB haplotypes. The results showed a close relationship of the detected SHB strains to those originating from the USA, Canada and Costa Rica (Fig. 3).
Phylogenetic tree of mitochondrial cytochrome
Four adult samples and one larval sample of SHB were used for the detection of fourteen prevalent honey bee pathogens by specific conventional PCR (Tab. 1). The results showed that two of the fourteen honey bee pathogens were detected in the adult SHB (DWV and BQCV), of which, DWV was detected in all four adult samples, and BQCV was detected in three adult samples. The result was confirmed through electrophoresis with the expected band of 479 bp and 701 bp long for DWV and BQCV detection, respectively (Fig. 4).
Detection of honeybee pathogens in small hive beetle (SHB). Positive results of black queen cell virus (A) and deformed wing virus (B) detection were confirmed with expected band, 701 bp and 479 bp long, respectively, in electrophoresis. Lanes 1 to 4 were for four SHB samples. “M” is a 100-bp DNA marker. “+” and “-” are positive using recombinant DNA and negative control without DNA template, respectively.
An SHB infestation was recorded in 2016 in Miryang, and this outbreak spread to the surrounding areas, including Changyeong in the same province (Lee et al., 2017; Namin et al., 2019). The invasion poses a threat to apiculture in South Korea, particularly regarding the possibility of spreading to Asian honey bee (
The positive detection of DWV and BQCV among the fourteen prevalent honey bee pathogens in SHB suggests that this pest has the potential to be a natural reservoir of these two viruses, and the spread of SHB could contribute to the transmission of these two honey bee pathogens in South Korean apiculture. BQCV was detected in SHB for the first time in this study. Increasing the scale of surveillance across the whole country for detection of SHB, honey bee pathogens carried by SHB, and the role of SHB in the spread of honey bee pathogens is important for controlling SHB and to mitigate the damage to the beekeeping industry.
Phylogenetic methods are useful for tracing the origin of SHB (Li et al., 2018). The high sequence homology of the COI gene of the South Korean SHB with that of the USA populations and phylogenetic analysis showed a close relationship between the Korean SHB and those originated from USA, Canada and Costa Rica. The analysis of the COI gene suggested that the USA population originated from the SHB population in South Africa (Evans et al., 2000), which was also the origin of the Australian population (Lounsberry et al., 2010; Namin et al., 2019). This suggests that the Korean and Canadian variant of SHB could have originated from the USA. Furthermore, the low variation of the COI gene and restricted area of the original invasion of SHB in South Korea suggest that this pest was introduced into South Korea from a single source to a specific region. However, it could not be confirmed whether the South Korean SHB was introduced from USA, Canada, or Costa Rica. Further study on microsatellite analysis (Evans et al., 2008) of samples collected from these countries could be useful in identifying the origin of Korean SHB. Understanding the global movement of SHB is important to identify the routes of invasion and to establish a strategy to control the spread of SHB through the trade of honey bees and such bee products as beeswax (Idrissou et al., 2019).
Our results showed that the SHB detected in South Korea carried two honey bee viral pathogens. This information is useful for further research on the role of SHB in the transmission of honey bee pathogens. The present study was also conducted to analyse the phylogenetic relationships of South Korean SHB collected in Damyang and Miryang where the invasion of SHB into South Korea was first reported. The sequence analysis of the COI gene showed a close relationship between the South Korean SHB and those from USA, Canada and Costa Rica. However, the pathway of invasion remains unclear. Therefore, the strict examination of trade in honey bees or honey bee products could be important to control the spread of SHB.