<abstract xmlns="http://www.w3.org/1999/xhtml">Xylooligosaccharides (XOS) are the oligomers of β-1,4 linked xylose monomers and they have health promoting effect by modulating the beneficial microorganisms in intestine. In this study, hydrolysate obtained from hemp (<italic>Cannabis sativa</italic>) shives was investigated in terms of its in vitro toxicological impacts at cellular and genetic levels and antioxidant activity. The hydrolysate was found to contain 0.264 mg mL-1 of xylose, 0.789 mg mL-1 of xylobiose and 0.171 mg mL-1 of xylotriose in addition to hydroxymethlyfurfural (HMF) and furfural (F) at concentrations of 0.545 mg mL-1 and 0.107 mg mL-1, respectively. The cells, colon epithelial cells (CoN) and colon cancer cells (Caco-2), exposed to 5.00 mg mL-1 or lower XOS hydrolysate showed very similar growth profiles to the untreated control cells. At the genetic level, the oxidative responses of the cell types to XOS hydrolysate were different as measured by <italic>NFE2L2</italic> (Nuclear factor, erythroid-derived 2-like 2) gene expression. Regarding antioxidant activity, the amount of XOS hydrolysate (IC50) that cleared 50 % of the 2,2-diphenyl-l-picrylhydrazyl (DPPH) in the medium was calculated as 0.12 mg mL-1. To conclude, based on in vitro studies, XOS hydrolysate obtained from lignocellulosic hemp shives emerges as an innovative, alternative and safe functional food candidate.</abstract>

Xylooligosaccharides (XOS) are the oligomers of β-1,4 linked xylose monomers and they have health promoting effect by modulating the beneficial microorganisms in intestine. In this study, hydrolysate obtained from hemp (Cannabis sativa) shives was investigated in terms of its in vitro toxicological impacts at cellular and genetic levels and antioxidant activity. The hydrolysate was found to contain 0.264 mg mL-1 of xylose, 0.789 mg mL-1 of xylobiose and 0.171 mg mL-1 of xylotriose in addition to hydroxymethlyfurfural (HMF) and furfural (F) at concentrations of 0.545 mg mL-1 and 0.107 mg mL-1, respectively. The cells, colon epithelial cells (CoN) and colon cancer cells (Caco-2), exposed to 5.00 mg mL-1 or lower XOS hydrolysate showed very similar growth profiles to the untreated control cells. At the genetic level, the oxidative responses of the cell types to XOS hydrolysate were different as measured by NFE2L2 (Nuclear factor, erythroid-derived 2-like 2) gene expression. Regarding antioxidant activity, the amount of XOS hydrolysate (IC50) that cleared 50 % of the 2,2-diphenyl-l-picrylhydrazyl (DPPH) in the medium was calculated as 0.12 mg mL-1. To conclude, based on in vitro studies, XOS hydrolysate obtained from lignocellulosic hemp shives emerges as an innovative, alternative and safe functional food candidate.

Safety assessment of the innovative functional food ingredient from <italic>Cannabis sativa</italic> L. wastes

The EuroBiotech Journal

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Safety assessment of the innovative functional food ingredient from  L. wastes

Xylooligosaccharides (XOS) are the oligomers of β-1,4 linked xylose monomers and they have health promoting effect by modulating the beneficial microorganisms...

Treatment		Duplication time (h)
XOS hydrolysate	CoN (normal colon cells)	Caco-2 (colon cancer cells)
Control	30.78 ± 0.50	53.65 ± 4.56
1.25 mg mL^-1	28.75± 0.67	37.70 ± 1.35
2.50 mg mL^-1	25.97± 0.32	26.97 ± 0.54
5.00 mg mL^-1	27.05± 0.21	47.19 ± 0.78

Primer pairs	Sequence	Product size	Annealing T (°C)	Cycle
NFE2L2 Sense	5’GCGACGGAAAGAGTATGAGC3’	181 bp	60	25
NFE2L2 Antisense	5’GTTGGCAGATCCACTGGTTT3’	181 bp	60	25
β-actin Sense	5’TGAGCGCGGCTACAGCTT3’	120 bp	56	35
β-actin Antisense	5’TCCTTAATGTCACGCACGATTT3’	120 bp	56	35

Safety assessment of the innovative functional food ingredient from Cannabis sativa L. wastes

Article Category: Research Article

Data publikacji: 19 lip 2020

Zakres stron: 134 - 143

DOI: https://doi.org/10.2478/ebtj-2020-0015

Słowa kluczowe
Colon cancer, functional food, hemp shives, cytotoxicity, L., xylooligosaccharides

© 2020 Fatmanur Gönce, Elmas Ersöz, Meryem Kara, Gökhan Kars, Saliha Dinç, Serpil Edebali, Manuel Roman, Meltem D. Kars, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Duplication time (td) of cell lines after XOS hydrolysate supplementation

Oligonucleotide sequences and PCR conditions

Safety assessment of the innovative functional food ingredient from Cannabis sativa L. wastes

Article Category: Research Article

Data publikacji: 19 lip 2020

Zakres stron: 134 - 143

DOI: https://doi.org/10.2478/ebtj-2020-0015

Słowa kluczoweColon cancer, functional food, hemp shives, cytotoxicity, L., xylooligosaccharides

© 2020 Fatmanur Gönce, Elmas Ersöz, Meryem Kara, Gökhan Kars, Saliha Dinç, Serpil Edebali, Manuel Roman, Meltem D. Kars, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Duplication time (td) of cell lines after XOS hydrolysate supplementation

Oligonucleotide sequences and PCR conditions

Słowa kluczowe
Colon cancer, functional food, hemp shives, cytotoxicity, L., xylooligosaccharides