Uneingeschränkter Zugang

Safety assessment of the innovative functional food ingredient from Cannabis sativa L. wastes

Fatmanur Gönce

Fatmanur Gönce

Department of Nanotechnology and Advanced Materials, Institute of Science, Selçuk UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Gönce, Fatmanur
, 
Elmas Ersöz

Elmas Ersöz

Department of Nutrition and Dietetics, Akşehir Kadir Yallagöz School of Health, Selçuk UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Ersöz, Elmas
, 
Meryem Kara

Meryem Kara

Department of Food Technology, Çumra Vocational School, Selçuk UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Kara, Meryem
, 
Gökhan Kars

Gökhan Kars

Department of Molecular Biology and Genetics, Faculty of Science, Necmettin Erbakan UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Kars, Gökhan
, 
Saliha Dinç

Saliha Dinç

Department of Organic Agricultural Management, Çumra School of Applied Sciences, Selçuk UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Dinç, Saliha
, 
Serpil Edebali

Serpil Edebali

Department of Chemical Engineering, Faculty of Natural Sciences and Engineering, Konya Technical UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Edebali, Serpil
, 
Manuel Roman

Manuel Roman

  • Contactica S.L.Madrid, Spain
  • Isanatur S.L.Navarra, Spain
Suche nach diesem Autor auf
Sciendo|Google Scholar
Roman, Manuel
 und 
Meltem D. Kars

Meltem D. Kars

Department of Animal and Herbal Production, Meram Vocational School, Necmettin Erbakan UniversityKonya, Turkey
Suche nach diesem Autor auf
Sciendo|Google Scholar
Kars, Meltem D.
  
19. Juli 2020
Safety assessment of the innovative functional food ingredient from Cannabis sativa L. wastes's Cover Image
Über diesen Artikel
Vorheriger Artikel
Nächster Artikel
Zitieren
COVER HERUNTERLADEN
Artikel-Kategorie: Research Article
Online veröffentlicht: 19. Juli 2020
Seitenbereich: 134 - 143
DOI: https://doi.org/10.2478/ebtj-2020-0015
Schlüsselwörter
© 2020 Fatmanur Gönce, Elmas Ersöz, Meryem Kara, Gökhan Kars, Saliha Dinç, Serpil Edebali, Manuel Roman, Meltem D. Kars, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 License.

Figure 1

Microscopic appearence of the cells a) CoN normal colon epithelial cells, b) Caco-2 colon cancer cells.
Microscopic appearence of the cells a) CoN normal colon epithelial cells, b) Caco-2 colon cancer cells.

Figure 2

Schematic representation of a) HPLC chromatogram of HMF and furfural and b) Calibration curves of HMF and furfural standards.
Schematic representation of a) HPLC chromatogram of HMF and furfural and b) Calibration curves of HMF and furfural standards.

Figure 3

Real-time cell proliferation analysis: Effects of XOS hydrolysate supplementation on proliferation ofa) CoN cormal colon cells, b) Caco-2 colon cancer cells.
Real-time cell proliferation analysis: Effects of XOS hydrolysate supplementation on proliferation ofa) CoN cormal colon cells, b) Caco-2 colon cancer cells.

Figure 4

a) CoN and Caco-2 total RNA samples; ribosomal RNA subunits (28S, 18S) on 1% agarose gel.b) RT-PCR products for control and treated cells (NFE2L2 and β-actin genes).
a) CoN and Caco-2 total RNA samples; ribosomal RNA subunits (28S, 18S) on 1% agarose gel.b) RT-PCR products for control and treated cells (NFE2L2 and β-actin genes).

Figure 5

Schematic representation of densitometric analysis of normalized NFE2L2 gene expression levels in normal (CoN) and colon cancer cells (Caco-2).
Schematic representation of densitometric analysis of normalized NFE2L2 gene expression levels in normal (CoN) and colon cancer cells (Caco-2).

Figure 6

Graphical representations of DPPH scavenging activities of a) XOS hydrolysate and b) Ascorbic acid (L-ASA).
Graphical representations of DPPH scavenging activities of a) XOS hydrolysate and b) Ascorbic acid (L-ASA).

Duplication time (td) of cell lines after XOS hydrolysate supplementation

TreatmentDuplication time (h)
XOS hydrolysateCoN (normal colon cells)Caco-2 (colon cancer cells)
Control30.78 ± 0.5053.65 ± 4.56
1.25 mg mL-128.75± 0.6737.70 ± 1.35
2.50 mg mL-125.97± 0.3226.97 ± 0.54
5.00 mg mL-127.05± 0.2147.19 ± 0.78

Oligonucleotide sequences and PCR conditions

Primer pairsSequenceProduct sizeAnnealing T (°C)Cycle
NFE2L2 Sense5’GCGACGGAAAGAGTATGAGC3’181 bp6025
NFE2L2 Antisense5’GTTGGCAGATCCACTGGTTT3’
β-actin Sense5’TGAGCGCGGCTACAGCTT3’120 bp5635
β-actin Antisense5’TCCTTAATGTCACGCACGATTT3’
Sprache:
Englisch
Zeitrahmen der Veröffentlichung:
4 Hefte pro Jahr
Fachgebiete der Zeitschrift:
Biologie, Genetik, Biotechnologie, Bioinformatik, Biologie, andere
Zeitschrift RSS Feed