Otwarty dostęp

miR-30c-2-3p suppresses the proliferation of human renal cell carcinoma cells by targeting TOP2A

Xiaoyong Huang

Xiaoyong Huang

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Huang, Xiaoyong
, 
Yuna Jia

Yuna Jia

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Jia, Yuna
, 
Haiyan Shi

Haiyan Shi

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Shi, Haiyan
, 
Haiyan Fan

Haiyan Fan

Department of Laboratory, The First Hospital of YulinYulin, China
Wyszukaj tego autora
Sciendo|Google Scholar
Fan, Haiyan
, 
Lingbo Sun

Lingbo Sun

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Sun, Lingbo
, 
Huahua Zhang

Huahua Zhang

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Zhang, Huahua
, 
Yanfeng Wang

Yanfeng Wang

Clinical Laboratory of Affiliated Hospital of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Wang, Yanfeng
, 
Jie Chen

Jie Chen

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Chen, Jie
, 
Jiaqi Han

Jiaqi Han

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Han, Jiaqi
, 
Mingming Wang

Mingming Wang

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Wang, Mingming
, 
Juan Du

Juan Du

Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Du, Juan
 oraz 
Jing Zhang

Jing Zhang

  • Department of Clinical Medicine, Medical College of Yan’an UniversityYan’an, China
  • Yan’an Key Laboratory of Chronic Disease Prevention and ResearchYan’an, China
Wyszukaj tego autora
Sciendo|Google Scholar
Zhang, Jing
  
09 paź 2023
miR-30c-2-3p suppresses the proliferation of human renal cell carcinoma cells by targeting TOP2A's Cover Image
O artykule
Poprzedni artykuł
Następny artykuł
Zacytuj
Pobierz okładkę
Kategoria artykułu: Original article
Data publikacji: 09 paź 2023
Zakres stron: 124 - 135
DOI: https://doi.org/10.2478/abm-2023-0052
Słowa kluczowe
© 2023 Xiaoyong Huang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1.

miR-30c-2-3p expression in RCC cells. (A) The TCGA database was used to undertake an expression study of miR-30c-2-3p in RCC tissues (n = 241) and normal adjacent tissues (n = 70). (B) Analysis of the 5-year overall survival rate for RCC patients. (C) The expression of miR-30c-2-3p in RCC cell lines (786-O, Caki-1, and ACHN) and normal renal tubular epithelial cell line was examined using qRT-PCR (HK-2). ***P < 0.001.miR, microRNA; qRT-PCR, quantitative real-time polymerase chain reaction; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas.
miR-30c-2-3p expression in RCC cells. (A) The TCGA database was used to undertake an expression study of miR-30c-2-3p in RCC tissues (n = 241) and normal adjacent tissues (n = 70). (B) Analysis of the 5-year overall survival rate for RCC patients. (C) The expression of miR-30c-2-3p in RCC cell lines (786-O, Caki-1, and ACHN) and normal renal tubular epithelial cell line was examined using qRT-PCR (HK-2). ***P < 0.001.miR, microRNA; qRT-PCR, quantitative real-time polymerase chain reaction; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas.

Figure 2.

RCC cells experience reduced proliferation and increased apoptosis when miR-30c-2-3p is expressed more typically. (A) miR-30c-2-3p expression after transfection. (B) Cell proliferation at 24 h, 48 h, and 72 h posttransfection. (C) After transfection, 786-O, Caki-1, and ACHN cells form colonies. (D) Analysis of apoptosis by flow cytometry following transfection with NC or miR-30c-2-3p mimics. (E) Fas, FasL, caspase 3, and caspase 8 protein expression in 786-O, Caki-1, and ACHN cells after miR-30c-2-3p mimic transfection or NC. *P < 0.05, **P < 0.01, ***P < 0.001. miR, microRNA; NC, negative control; RCC, renal cell carcinoma; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.
RCC cells experience reduced proliferation and increased apoptosis when miR-30c-2-3p is expressed more typically. (A) miR-30c-2-3p expression after transfection. (B) Cell proliferation at 24 h, 48 h, and 72 h posttransfection. (C) After transfection, 786-O, Caki-1, and ACHN cells form colonies. (D) Analysis of apoptosis by flow cytometry following transfection with NC or miR-30c-2-3p mimics. (E) Fas, FasL, caspase 3, and caspase 8 protein expression in 786-O, Caki-1, and ACHN cells after miR-30c-2-3p mimic transfection or NC. *P < 0.05, **P < 0.01, ***P < 0.001. miR, microRNA; NC, negative control; RCC, renal cell carcinoma; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.

Figure 3.

TOP2A is the direct target of miR-30c-2-3p. (A) Predicted binding site of miR-30c-2-3p in TOP2A mRNA 3′-UTR. (B) The sequences of wild-type (TOP2A W) and mutant (TOP2A M) genes. (C) Dual-luciferase reporter assay to determine the influence of miR-30c-2-3p on wild-type and mutant miR-30c-2-3p binding site on TOP2A 3‘-UTR. Cells transfected with miR-30c-2-3p overexpression plasmid and GLO plasmids were used as controls. (D, E) TOP2A mRNA and protein expression in 786-O, Caki-1, and ACHN cells following transfection with miR-30c-2-3p mimics or NC. **P < 0.01.miR, microRNA; NC, negative control TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.
TOP2A is the direct target of miR-30c-2-3p. (A) Predicted binding site of miR-30c-2-3p in TOP2A mRNA 3′-UTR. (B) The sequences of wild-type (TOP2A W) and mutant (TOP2A M) genes. (C) Dual-luciferase reporter assay to determine the influence of miR-30c-2-3p on wild-type and mutant miR-30c-2-3p binding site on TOP2A 3‘-UTR. Cells transfected with miR-30c-2-3p overexpression plasmid and GLO plasmids were used as controls. (D, E) TOP2A mRNA and protein expression in 786-O, Caki-1, and ACHN cells following transfection with miR-30c-2-3p mimics or NC. **P < 0.01.miR, microRNA; NC, negative control TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.

Figure 4.

Expression of TOP2A in RCC tissues and cell lines. (A) Expression analysis of TOP2A in RCC tissues (n = 534) and normal adjacent tissues (n = 72) performed in TCGA database. (B) Five-year overall survival percentage analysis of patients with RCC. (C, D) TOP2A expression in 786-O, Caki-1, ACHN, and HE-2 cells. (E) TOP2A expression in RCC and adjacent tissues. **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.
Expression of TOP2A in RCC tissues and cell lines. (A) Expression analysis of TOP2A in RCC tissues (n = 534) and normal adjacent tissues (n = 72) performed in TCGA database. (B) Five-year overall survival percentage analysis of patients with RCC. (C, D) TOP2A expression in 786-O, Caki-1, ACHN, and HE-2 cells. (E) TOP2A expression in RCC and adjacent tissues. **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.

Figure 5.

TOP2A interference inhibits growth of RCC cells and promotes their apoptosis. ACHN, 786-O, and Caki-1 cells were transfected with shTOP2A-1, shTOP2A-2, or a negative control. (A, B) TOP2A mRNA and protein abundance after transfection. (C) Cell proliferation after transfection. (D) Colony formation in 786-O, Caki-1, and ACHN cells after transfection. (E) Study of apoptosis by flow cytometry following transfection with shTOP2A-1, shTOP2A-2, or a negative control. (F) Expression of Fas, FasL, caspase 8, and caspase 3 after transfection with shTOP2A-1, shTOP2A-2, or a negative control. *P < 0.05, **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.
TOP2A interference inhibits growth of RCC cells and promotes their apoptosis. ACHN, 786-O, and Caki-1 cells were transfected with shTOP2A-1, shTOP2A-2, or a negative control. (A, B) TOP2A mRNA and protein abundance after transfection. (C) Cell proliferation after transfection. (D) Colony formation in 786-O, Caki-1, and ACHN cells after transfection. (E) Study of apoptosis by flow cytometry following transfection with shTOP2A-1, shTOP2A-2, or a negative control. (F) Expression of Fas, FasL, caspase 8, and caspase 3 after transfection with shTOP2A-1, shTOP2A-2, or a negative control. *P < 0.05, **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.

Figure 6.

RCC development regulated by miR-30c-2-3p is caused by TOP2A. (A, B) TOP2A expression in 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). (C, D) Viability and colony formation results of 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). (E) Apoptosis changes of 786-O, Caki-1, and ACHN cells pre-transfected with different RNAs for 48 h. (F) Abundance of Fas/FasL/caspase 8/caspase 3/Bcl2/caspase 9 proteina in 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). *P < 0.05, **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.
RCC development regulated by miR-30c-2-3p is caused by TOP2A. (A, B) TOP2A expression in 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). (C, D) Viability and colony formation results of 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). (E) Apoptosis changes of 786-O, Caki-1, and ACHN cells pre-transfected with different RNAs for 48 h. (F) Abundance of Fas/FasL/caspase 8/caspase 3/Bcl2/caspase 9 proteina in 786-O, Caki-1, and ACHN cells treated with miR-30c-2-3p inhibitors (miR-30c-in) and/or TOP2A interference RNAs (shTOP2A). *P < 0.05, **P < 0.01, ***P < 0.001.miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.

Figure S1.

Transfection efficiency verification of miR-30c-2-3p inhibitor. (A) miR-30c-2-3p expression after transfection with NC or miR-30c-2-3p inhibitor. (B) The mRNA expression of TOP2A after transfection with NC or miR-30c-2-3p inhibitor. (C) TOP2A protein expression in 786-O, Caki-1, and ACHN cells after miR-30c-2-3p mimic transfection or NC. **P < 0.01, ***P < 0.001.miR, microRNA; TOP2A, DNA topoisomerase II alpha.
Transfection efficiency verification of miR-30c-2-3p inhibitor. (A) miR-30c-2-3p expression after transfection with NC or miR-30c-2-3p inhibitor. (B) The mRNA expression of TOP2A after transfection with NC or miR-30c-2-3p inhibitor. (C) TOP2A protein expression in 786-O, Caki-1, and ACHN cells after miR-30c-2-3p mimic transfection or NC. **P < 0.01, ***P < 0.001.miR, microRNA; TOP2A, DNA topoisomerase II alpha.

Primers used in this work

Name Sequence (5′–3′)
TOP2A-R TTGGCATCATCGAGTTTGGGA
TOP2A-F TGGCTGTGGTATTGTAGAAAGC
GAPDH-F GACTTCAACAGCAACTCCCA
GAPDH-R TGGGTGGTCCAGGGTTTCTT
miR-30c-2-3p-RT GTCGTATCCAGTGCGTGTCGTGGA-GTCGGCAATTGCACTGGATACGACAGAGTAA
miR-30c-2-3p-F ATCCAGTGCGTGTCGTG
miR-30c-2-3p-R TGCTCTGGGAGAAGGCTGT
U6-RT CGCTTCACGAATTTGCGTGTCAT
U6-R CGCTTCACGAATTTGCGTGTCAT
U6-F GCTTCGGCAGCACATATACTAAAAT
Język:
Angielski
Częstotliwość wydawania:
6 razy w roku
Dziedziny czasopisma:
Medycyna, Zawody pomocnicze, pielęgniarstwo, Podstawowe nauki medyczne, Podstawowe nauki medyczne, inne, Medycyna kliniczna, Medycyna kliniczna, inne
Kanał RSS czasopisma