Among genitourinary tumors, renal cell carcinoma (RCC) is one of the most common malignancies [1]. Patients with RCC typically do not present with obvious clinical symptoms and, thus, are largely diagnosed at advanced stages. Furthermore, the majority of RCC patients are less sensitive to chemotherapy or radiotherapy, thus contributing to poor 5-year survival trends [2, 3]. To date, the incidence of RCC is increasing worldwide and its pathogenesis remains unclear [4, 5], highlighting the need to further investigate the underlying mechanisms and develop RCC-specific tumor markers to enhance the diagnosis of patients with RCC.
By controlling the expression of their target genes, microRNAs (miRNAs), which are RNAs with 14–24 nucleotides, play a crucial part in a variety of biological processes [6]. miR-30c-2 is a member of the miR-30c family of molecules located on chromosome 6q13 [7]. In gastric cancer cells, it blocks cell cycle progression, enhances apoptosis, and reduces cell viability by directly regulating regulating ras-related protein in brain 31(RAB31)–gliomaassociated oncogene homolog 1(GLI1) signaling [8]. miR-30c-2-3p downregulates the expression of TNF receptor-associated death domain TRAND and nuclear factor kappa B (NF-κB), thereby inhibiting NF-κB–cyclin E1 (CCNE1) signaling in breast cancer cells, and it is interesting to note that patients with breast cancer who have higher miR-30c-2-3p expression tend to survive longer [9]. By using bioinformatics, miR-30c-2-3p-binding sites were predicted to be in the 3′-UTR region of DNA topoisomerase II alpha (TOP2A). The expression profiles of miR-30c-2-3p and TOP2A are inverse, implying that this miRNA might be involved in the coordination of TOP2A expression.
TOP2A is one of the 2 type II DNA topoisomerase iso-forms that exist in vertebrates, and it regulates DNA replication and cell division by altering DNA topology [10, 11]. To permit the proper localization of this enzyme, histone H2A must be phosphorylated at Thr-120 (H2ApT120) and lysine 1240 of TOP2A must be sumoylated [11, 12]. These events enable TOP2A to bind directly to the centromere of mitotic chromosomes to correctly regulate the separation of sister chromatids and safeguard genomic stability. As TOP2A is highly expressed in numerous tumor types, it may act as an oncogene [13, 14]. Additionally, TOP2A interacts with murine double minute 4 (MDM4), inhibiting p53, thereby increasing cancer cell proliferation [14]. Moreover, TOP2A accelerates the development of gall bladder and cervical cancers by triggering the phosphoinositide3-kinase (PI3K)/protein kinase B (AKT) signaling pathway [15, 16]. Bioinformatic analyses have revealed a negative correlation between TOP2A expression and the prognosis of RCC patients [17, 18]. However, the functions of miR-30c-2-3p in RCC and their connections to the expression of TOP2A are still unknown. Thus, the effects of miR-30c-2-3p on TOP2A expression and RCC growth were examined in this study. The findings of this study contribute to an estimation of miR-30c-2-3p and TOP2A's diagnostic and therapeutic potential for RCC.
The Cancer Genome Atlas (TCGA) database (
Twenty-five paired RCC and adjacent nontumor kidney tissues were obtained from patients of the Affiliated Hospital of Yan’an University, Shaanxi, China. All patients were clinically diagnosed with RCC based on the 2015 Chinese Society of Clinical Oncology Guidelines for the Treatment of Renal Carcinoma[20]. All procedures conducted in this study were approved by the Ethics Committee of Yan’an University (approval number 2019104). Written informed consent for tissue usage and research publication was obtained from all patients.
RCC cell lines 786-O, Caki-1, ACHN, and normal renal tubular epithelium cell line (HK-2) were derived from Medical Research and Experiment Center of Yan’an University. HK-2 and 786-O cells were cultured in Roswell Park Memorial Institute (RPMI)-1640 medium. Caki-1 cells and ACHN cells were cultured in McCoy's 5A medium and Eagle's minimum essential medium, respectively. All of the above media were obtained from Biological Industries (Beit Haemek, Israel) and contained 10% fetal bovine serum. Cells were cultured in 5% CO2 at 37 °C.
Homo sapiens (hsa)-miR-30c-2-3p (miR-30c-2-3p) mimics, hsa-miR-30c-2-3p inhibitor (miR-30c-2-3p inhibitor), and their negative controls (NCs) (miR-30c-2-3p mimic NCs and miR-30c-2-3p inhibitor NCs) were synthesized by Gene Pharma Biotech. The TOP2A interference vectors (short hairpin [sh]TOP2A-1 and shTOP2A-2) and the empty vector (shTOP2A NC) were synthesized by Genechem. Cells were transfected with jetPRIME (Polyplus) according to the manufacturer's instructions [19].
Total RNA was isolated from cells using TRIzol reagent (TransGen Biotech), in accordance with the manufacturer's instructions. miRNAs were extracted using a miRcute miRNA extraction kit (Tiangen Biotech). For cDNA fragment synthesis, EasyScript One-Step gDNA Transcription Kit (TransGen Biotech) was used. cDNA fragments for protein-coding genes were synthesized using the RNA templates with Oligo dT primer, while U6 and miR-30c-2-3p cDNA were synthesized using the miRNA template and gene-specific primers. Relative gene expression of miR-30c-2-3p and
Primers used in this work
TOP2A-R | TTGGCATCATCGAGTTTGGGA |
TOP2A-F | TGGCTGTGGTATTGTAGAAAGC |
GAPDH-F | GACTTCAACAGCAACTCCCA |
GAPDH-R | TGGGTGGTCCAGGGTTTCTT |
miR-30c-2-3p-RT | GTCGTATCCAGTGCGTGTCGTGGA-GTCGGCAATTGCACT |
miR-30c-2-3p-F | ATCCAGTGCGTGTCGTG |
miR-30c-2-3p-R | TGCTCTGGGAGAAGGCTGT |
U6-RT | CGCTTCACGAATTTGCGTGTCAT |
U6-R | CGCTTCACGAATTTGCGTGTCAT |
U6-F | GCTTCGGCAGCACATATACTAAAAT |
F, forward; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; miR, micoRNA; R, reverse; RT, reverse transcription primer; TOP2A, DNA topoisomerase II alpha.
TOP2A expression was examined in tissues using a streptavidin–horseradish peroxidase (HRP) kit (ZSGB-BIO) and rabbit anti-human TOP2A polyclonal antibody (1:500; Proteintech; research resource identifier (RRID): AB_10664923). After deparaffinization, the slides were subjected to antigen retrieval by autoclaving in 0.01 M ethylenediaminetetraacetic acid (EDTA) buffer (pH 8.5) for 3 min 15 s, followed by incubation in 3% H2O2 for 10 min to quench endogenous peroxidase. Sections were incubated overnight at 4 °C with rabbit anti-human TOP2A polyclonal antibody. Slides were washed with phosphate-buffered saline (PBS) 3 times and incubated with secondary antibody (PV9000; ZSGB-BIO) at room temperature for 0.5 h. Staining was carried out by incubating the slides in 3,3′-diaminobenzidine, followed by counterstaining with hematoxylin and dehydration in gradient ethanol and xylene. Protein expression level was analyzed through ImageJ (Rawak Software) assessment of the average gray value of positive cells. TOP2A is localized in the nuclei of tumor cells, so we selected the nuclear staining mode.
RIPA buffer with protease inhibitors (protease inhibitor cocktail; MCE) was used to obtain whole-cell protein extracts. The bicinchoninic acid (BCA) Protein Assay Kit (Solarbio) was used to determine the protein concentration. The protein extract was electrophoretically transferred to a polyvinylidene fluoride (PVDF) membrane after separation using sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE). Antibodies against TOP2A (#20233-1-AP; 1:800; Proteintech), Fas (#4233S; 1:1,000; Cell Signaling Technology), FasL (#5237S; 1:1,000; Cell Signaling Technology), caspase 9 (#9502T; 1:1,000; Cell Signaling Technology), caspase 8 (#13423-1-AP; 1:1,000; Proteintech), Bcl-2 (#12789-1-AP; 1:1,000; Proteintech), caspase 3 (#10380-1-AP; 1:1,000; Proteintech), b-tubulin, and b-actin (TRAN) were used for detection with a G: BOX Chemi xx9 system (Syngene). HRP-labeled goat anti-rabbit IgG (#A0208; 1:2,000) and HRP-labeled goat anti-mouse IgG (#A0216; 1:2,000) were purchased from Beyotime.
We constructed 2 vectors: one consisting of the fragments of the TOP2A 3′-UTR region (blinded by the miR-30c-2p binding site), which was inserted into the pmirGLO vectors; the other consisting of the mutated TOP2A 3′-UTR region of miR-30c-2p binding sites, which was also inserted into the pmirGLO vectors, named pmirGLO-TOP2A-WT (TOP2A W) and pmirGLO-TOP2A-MuT (TOP2A M), respectively. HEK-293T cells were pre-transfected with miR30c-2-3p-mimics and pmirGLO-TOP2A-WT, pmirGLO-TOP2A-MuT, or empty pmirGLO vectors; firefly and
Each well of a 96-well plate received 3,000 cells overall. After transfection, an aliquot (10 μL) of CCK-8 reagent (Beyotime) was added to each well at 0 h, 24 h, 48 h, and 72 h. At 450 nm, the absorbance was measured 1 h after CCK-8 supplementation [19].
At 24 h after transfection, 1,000 cells per well in each group were inoculated into 12-well plates. Two weeks later, cells were anchored with 4% polymerized formaldehyde, washed with PBS, and stained with 0.1% crystal violet. For absorbance detection, cells were pretreated with dimethyl sulfoxide, and the absorbance of the supernatant was measured at 570 nm [19].
Apoptosis was detected 48 h after cell transfection using the Annexin V/propidium iodide double staining kit (BestBio) with a flow cytometry system (CyFlow Cube8, Sysmex).
For data representation, the mean and standard deviation are used. Data were examined using the software GraphPad Prism 8 (GraphPad Software, Inc.). Measurement data conforming to normal distribution were analyzed by Student t test or one-way analysis of variance (ANOVA). Measurement data that do not conform to the normal distribution used the rank sum test.
When we examined the expression of miR-30c-2-3p in RCC tissues from the TCGA database, we discovered that it was considerably lower in 241 RCC tissues than it was in 70 healthy renal tissues (
miR-30c-2-3p expression in RCC cells.
miR, microRNA; qRT-PCR, quantitative real-time polymerase chain reaction; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas.
To investigate the role of miR-30c-2-3p in RCC cells, miR-30c-2-3p mimics were synthesized and successfully transfected into 786-O, Caki-1, and ACHN cells. qRT-PCR results indicated that transfection of the miR-30c-2-3p mimics dramatically increased the expression of miR-30c-2-3p (
RCC cells experience reduced proliferation and increased apoptosis when miR-30c-2-3p is expressed more typically.
To determine the role of miR-30c-2-3p in the regulation of RCC development, the potential binding sites of miR-30c-2-3p on TOP2A were predicted using the TargetScan database
TOP2A is the direct target of miR-30c-2-3p.
miR, microRNA; NC, negative control TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.
TCGA data analysis showed that, compared with normal kidney tissue (n=72), the expression of TOP2A was increased in RCC tissue (n=534); at the same time, we also analyzed the tissue data of 72 pairs of RCC patients and obtained consistent results (
Expression of TOP2A in RCC tissues and cell lines.
miR, microRNA; RCC, renal cell carcinoma; TCGA, The Cancer Genome Atlas; TOP2A, DNA topoisomerase II alpha; UTR, untranslated region.
We used RNA interference technology to reduce TOP2A expression in 786-O, Caki-1, and ACHN cells in order to ascertain TOP2A's role in RCC cells. The results of qRT-PCR and Western blotting showed that after transfection with shTOP2A-1 and shTOP2A-2, the mRNA and protein expressions of TOP2A in 786-O, Caki-1, and ACHN cells decreased significantly (
TOP2A interference inhibits growth of RCC cells and promotes their apoptosis. ACHN, 786-O, and Caki-1 cells were transfected with shTOP2A-1, shTOP2A-2, or a negative control.
miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.
RCC development regulated by miR-30c-2-3p is caused by TOP2A.
miR, microRNA; RCC, renal cell carcinoma; sh, short hairpin; TOP2A, DNA topoisomerase II alpha.
In order to further clarify the regulatory relationship between miR-30c-2-3p and TOP2A in RCC cells, miR-30c-2-3p inhibitor was transfected into the 786-O, Caki-1, and ACHN cells. As
Transfection efficiency verification of miR-30c-2-3p inhibitor. (
miR, microRNA; TOP2A, DNA topoisomerase II alpha.
qRT-PCR, Western blotting, CCK-8 assay, clone formation, and flow cytometry results demonstrated that miR-30c-2-3p inhibitor increased TOP2A protein expression, proliferation, and clonal formation, while blocking cell apoptosis. In contrast, shTOP2A induced the opposite effect. Cotransfection of shTOP2A with miR-30c-2-3p inhibitor reversed the effects of the miR-30c-2-3p inhibitor on TOP2A expression, cell viability, and apoptosis (
In our study, analysis of TCGA database revealed a low expression of miR-30c-2-3p in RCC tissues, which was supported by qRT-PCR in 3 RCC cell lines. Moreover, by increasing the expression of Fas, FasL, and caspase 3/8, miR-30c-2-3p mimics decreased RCC cell growth and induced apoptosis. These findings imply that miR-30c-2-3p may serve as a tumor suppressor gene affecting the biological operation of RCC cells. This finding is in line with that of Mathew et al. [7], who showed that in von-Hippel Lindau (VHL)-inactivated human clear cell renal cell carcinomas (ccRCCs), miR-30c-2-3p and miR-30a-3p inhibit ccRCC cell growth by specifically binding to, and inhibiting, hypoxia-inducible factor
TOP2A is a promising tumor marker for clinical applications. For instance, it mediates T-cell factor (TCF)-dependent epidermal–mesenchymal transition and promotes the development of colon cancer [22]. TOP2A is highly expressed in RCC, and its increased expression is associated with RCC occurrence, progression, and worse prognosis of the disease [23,24,25]. Additionally, Chen et al. [26] used the TCGA-kidney renal clear cell carcinoma (KIRC)cohort and qRT-PCR to verify the expression profiles of candidate marker genes in normal kidney tissues and primary tumors and metastases and determined that TOP2A can be used in the clinical diagnosis and treatment of RCC. Hence, overexpression of TOP2A can serve as an indicator of high-mortality risk in patients with RCC. According to the current study, TOP2A is highly expressed in RCC tissues and cells, and its expression negatively correlates with patient survival time. Reduction of TOP2A expression in RCC cells reduced cell proliferation and clone formation ability and increased apoptosis, which is consistent with reported data [27, 28]. The weakening of the phosphatase and tensin homolog (PTEN)/AKT signal leads to a decrease in TOP2A expression in breast cancer, which in turn promotes apoptosis through the ATP/caspase 3 signaling pathway [29]. In the present study, we discovered that the expression of Fas, FasL, caspase 8, and caspase 3 was elevated during the progression of RCC apoptosis by miR-30c-2-3p mimics or silencing TOP2A, even though the expression of BCL-2 and caspase 9 did not change significantly. This is consistent with previous findings in HeLa and Jurkat cells, which suggested that inhibition of TOP2A in tumor cells can induce apoptosis through a caspase-dependent pathway [30]. This result is important for enriching the regulatory network of TOP2A expression and illuminating the mechanism underlying the regulation of RCC cell growth by miR-30c-2-3p/TOP2A.
Although our research has shown that miR-30c-2-3p can control the proliferation of RCC cells by targeting TOP2A, more research is still required to fully understand the precise regulatory mechanism.
By targeting TOP2A, miR-30c-2-3p reduces the growth of RCC cells. While the specific mechanism of TOP2A regulating the Fas/FasL/caspase 8/caspase 3 signaling pathway needs to be further studied, the current findings offer fresh insights into the molecular mechanisms underpinning the effect of miR-30c-2-3p and TOP2A on the growth process in RCC. Thus, we conclude that both TOP2A and miR-30c-2-3p are promising targets in the treatment of RCC.