An interesting rare tylenchid species, Antarctenchus urmiensis n. sp. (Tylenchomorpha; Psilenchidae) from Urmia Lake islands, northwest Iran, with a discussion on the taxonomy of related genera
Data publikacji: 26 kwi 2021
Zakres stron: 1 - 14
DOI: https://doi.org/10.21307/jofnem-2021-045
Słowa kluczowe
© 2021 Mohammad Amiri Bonab et al., published by Sciendo.
This work is licensed under the Creative Commons Attribution 4.0 International License.
The taxonomy and phylogeny of tylenchids have already been studied and revised by several authors (Bert et al., 2008; De Ley and Blaxter, 2002; Holterman et al., 2009; Panahandeh et al., 2019; Sturhan, 2012; Subbotin et al., 2006). Following the molecular phylogenetic study of De Ley and Blaxter (2002), the order Tylenchida Thorne, 1949
Based on available data, few researchers have discussed about the status of Psilenchidae. Subbotin et al. (2006) gave a historic overview on the case, and recently Hosseinvand et al. (2020) followed the framework used by Geraert (2008), stating that the followed taxonomic frame is supported by their resolved SSU phylogeny (also see Discussion section).
During present study, a didelphic tylenchid population was recovered from the soil samples obtained from the Urmia Lake islands. By its typological similarities, and having a Tylenchidae-type cloacal bursa in male, i.e. lacking a bursa enveloping the tail or a trilobed bursa, common in dolichodoirds
Several soil samples were collected from different parts of the Urmia Lake islands, northwest Iran. The tray method (Whitehead and Hemming, 1965) was used to extract nematodes from soil samples. The nematodes of interest were handpicked under a Nikon SMZ1000 stereomicroscope, heat-killed by adding boiling 4% formalin solution, transferred to anhydrous glycerin according to De Grisse (1969), mounted in permanent slides and examined using a Nikon Eclipse E600 light microscope. Photographs were taken using an Olympus DP72 digital camera attached to an Olympus BX51 microscope powered with differential interference contrast (DIC). Drawings were made using a drawing tube attached to the microscope and were redrawn using the CorelDRAW® software version 12.
Scanning Electron Microscopy (SEM)Specimens preserved in glycerin were selected for observation under SEM according to Abolafia (2015). They were hydrated in distilled water, dehydrated in a graded ethanol-acetone series, critical point dried, coated with gold, and observed with a Zeiss Merlin microscope (5 kV) (Zeiss, Oberkochen, Germany).
A single nematode specimen of the new species was picked out and transferred to a small drop of TE buffer (10 mM Tris-Cl, 0.5 mM EDTA; pH 9.0, Qiagen) on a clean slide and squashed using a clean coverslip. The suspension was collected by adding 25 μl TE buffer. Two DNA samples were prepared in this manner. DNA samples were stored at −20°C until using as PCR templates. Primers for partial amplification of SSU rDNA were forward primer 22F (5´–TCCAAGGAAGGCAGCAGGC–3´) and revers primer 13R (5´–GGGCATCACAGACCTGTTA–3´) (Dorris et al., 2002). Sometimes the reverse primer 1573 R (5´–TACAAAGGGCAGGGACGTAAT–3´) (Mullin et al., 2005) was used interchangeably. The LSU rDNA D2-D3 expansion segments were amplified using the forward D2A (5´–ACAAGTACCGTGAGGGAAAGTTG–3´) and reverse D3B (5’–TCGGAAGGAACCAGCTACTA–3´) (Nunn, 1992) primer pairs. The PCR products were sequenced in both directions using the same primers used in PCR with an ABI3730XL sequencer. The newly obtained sequences were deposited into the GenBank database under the accession numbers MW208950 and MW208951 for SSU and MW208952 for LSU rDNA.
The newly obtained sequences were compared with those of other nematode species available in GenBank using the BLAST homology search program. For reconstruction of the phylogenetic relationships, two independent SSU and LSU datasets were prepared. The selected DNA sequences (representatives of most tylench genera were included) were aligned using Q-INS-i algorithm of the online version of MAFFT (version 0.91b) (
Figure 1:
Line drawings of

Figure 2:
Light micrographs of Antarctenchus urmiensis n. sp. (A,B,E,F,G,H,I,J,M,P,Q: Female; C,D,K,L,N,O,R: Male) (A-D) Anterior body end; (E) Anterior body region; (F) Pharyngeal median bulb; (G) Part of female reproductive system; (H) Distal end of ovary; (I) Pharyngeal bulb; (J) Lateral lines; (K) Male tail; (L) Phasmid; (M) Female tail; (N) Bursa; (O&P) Entire body; (Q) Vulval region; (R) Spicule and gubernaculum. (Scale bars: A-N, Q&R = 10 μm; O&P = 50 μm).

Figure 3:
Scanning electron microscopic (SEM) images of

See Table 1.
Morphometrics of
Holotype | Paratypes | ||
---|---|---|---|
Female | Females | Males | |
|
1 | 8 | 8 |
L | 1,095 | 1,022 ± 96 | 895 ± 40 |
(875–1,162) | (819–942) | ||
a | 45.6 | 41.7 ± 2.4 | 38.9 ± 2.3 |
(38.5–45.6) | (35.6–42.8) | ||
b | 6.7 | 6.5 ± 0.8 | 5.7 ± 0.3 |
(5.5–8.2) | (5.1–5.9) | ||
c | 15.2 | 15.5 ± 1.3 | 14.1 ± 0.6 |
(14.2–18.2) | (13.5–15.5) | ||
c´ | 5.5 | 5.1 ± 0.5 | 3.7 ± 0.2 |
(4.0–5.8) | (3.4–4.0) | ||
V | 54 | 55.0 ± 0.0 | – |
(54–58) | |||
Cephalic region width at apex | 6 | 6.4 ± 0.6 | 5.7 ± 0.5 |
(5.5–7.0) | (5.0–6.5) | ||
Cephalic region width at base | 9.5 | 9.5 ± 0.4 | 9.1 ± 0.3 |
(9.0–10.4) | (8.5–9.5) | ||
Cephalic region height | 2.8 | 2.8 ± 0.3 | 2.6 ± 0.3 |
(2.3–3.2) | (2.2–3.0) | ||
Stylet conus length | 5.5 | 5.5 ± 0.4 | 5.7 ± 0.7 |
(5–6) | (5–7) | ||
Stylet total length | 13 | 13.9 ± 0.4 | 14.0 ± 0.5 |
(13.0–14.5) | (13.5–15.0) | ||
Dorsal gland orifice (DGO) | 2.5 | 2.2 ± 0.3 | 2.4 ± 0.5 |
(2.0–2.8) | (2.0–3.2) | ||
Anterior end to median bulb distance | 69 | 68.6 ± 5.7 | 69.8 ± 1.8 |
(58–77) | (67–72) | ||
Median bulb length | 19 | 19.8 ± 1.3 | 20.8 ± 0.7 |
(18–21) | (20–22) | ||
Median bulb width | 11 | 11.1 ± 0.6 | 10.0 ± 0.5 |
(10–12) | (9–11) | ||
Anterior end to nerve ring distance | 101 | 109.3 ± 8.6 | 100.3 ± 7.0 |
(94–122) | (92–115) | ||
Anterior end to hemizonid distance | 117 | 121.6 ± 6.7 | 115.4 ± 4.9 |
(112–131) | (110–126) | ||
Anterior end to excretory pore distance | 121 | 127.4 ± 6.5 | 122.0 ± 4.6 |
(119–135) | (117–132) | ||
Neck (stoma + pharynx) | 162 | 158.3 ± 11.4 | 157.1 ± 3.0 |
(132–168) | (151–160) | ||
Anterior end to vulva distance | 592 | 568.4 ± 45.3 | – |
(511–644) | |||
Body width at vulva or cloaca | 24 | 24.6 ± 2.4 | 23.0 ± 0.8 |
(21–29) | (22–24) | ||
Body width at anus | 13 | 13.1 ± 2.2 | 17.4 ± 1.1 |
(11–18) | (16–19) | ||
Anterior genital branch/testis length | 254 | 261.6 ± 37.4 | 475.0 ± 35.8 |
(207–317) | (421–530) | ||
Posterior genital branch length | 250 | 254.1 ± 37.3 | – |
(208–332) | |||
Tail length | 72 | 66.3 ± 6.4 | 63.4 ± 2.9 |
(60–73) | (59–67) | ||
Anus to phasmid distance | 30 | 33.8 ± 4.1 | 34.4 ± 4.7 |
(27–42) | (27–43) | ||
Spicules length | – | – | 25.6 ± 1.6 |
(24–29) | |||
Gubernaculum length | – | – | 10.1 ± 1.0 |
(8–11) |
Body ventrally curved, C shape after fixation, slender (mostly at neck region), gradually narrowing towards distal end. Cuticle finely annulated all over the body (from post cephalic plate to tail tip), the transverse striae sometimes not reaching the lateral fields. Cephalic region low, wide, with four annuli in SEM, its base ca. 3.4 times the height, or ca. 1.5 times wider than the width at apex. Lateral fields with four lines in the anterior and posterior body region, increasing to six at mid-body. Deirid at secretory-excretory pore (S-E pore) level, phasmids at about mid-tail. Stylet short, its conus shorter than the shaft, abut 37–46% of the total stylet, with three tear-drop like knobs. The stylet guiding apparatus complex, usually three rings were observed, forming two chambers at shaft region. Pharynx tylenchoid, procorpus slender, metacorpus small, oval, at 40.0–45.8% of the pharynx with weak valve, isthmus narrow, pharyngeal bulb small, with usually one visible nucleus. Cardia large. Intestine simple, rectum and anus functional. S-E pore position just anterior of pharyngeal bulb. Hemizonid distinct, just anterior to S-E pore. Nerve ring encircling isthmus. Reproductive system didelphic-amphidelphic, each branch composed of an ovary, with oocytes in a single row, oviduct tubular, spermatheca spherical, empty, crustaformeria quadricolumellate, uterus tubular, vagina weakly sclerotized, vulva a transverse slit, its lips slightly protruding, vulval flap and epyptigma absent. Tail conical, not elongate-filiform, usually slightly ventrally bent, with a sharp or blunt tip and a small indentation at dorsal side close to tip.
Similar to female in general morphology except for reproductive system. Testis single, elongate, spermatocytes at single row behind germinal zone. Spicules tylenchoid, moderately sclerotized, slightly ventrally curved. Gubernaculum well sclerotized, crescent shaped. Bursa small, cloacal Tail similar to that of female.
The species name is named after the city of Urmia, from where the new species was recovered in one of the islands of the Urmia Lake.
Recovered from a soil sample collected in one of the islands of Urmia Lake, the Kaboodan island, Urmia, West Azarbaijan province, northwest Iran, in September 2019, in association with wild shrubs. The GPS coordinates for the locality are: 37°29′27.378″N 45°40′1.620″E.
Holotype female, seven paratype females, eight paratype males and four paratype juveniles were deposited in the nematode collection at the Faculty of Agriculture, Tarbiat Modares University, Tehran, Iran (five slides) Five paratype females and four paratype males (four slides) were deposited in the USDA Nematode Collection, Beltsville, MD. The new species binomial has been registered in the ZooBank database (zoobank.org) under the identifier: urn:lsid:zoobank.org:act:4FD480D0-4838-41E7-8AF3-708449E0B546. The LSID for the publication is: urn:lsid:zoobank.org:pub:5C029901-8785-47AB-9812-91C50F3B5E2A.
The new species was morphologically compared with the type and the only one representative species of the genus,
Compared to
Compared to
Compared to
Sequencing of SSU and LSU rDNA D2-D3 fragments of the new species yielded two 939 and 1076 nucleotide long partial SSU, and one 671 nucleotide long LSU D2-D3 sequences. The BLAST search using the longest SSU sequence (MW208950, used in the tree) revealed it has a 97.0–98.7% identity with several isolates of
A number of 96 sequences (including the newly generated sequences and the sequences of outgroup taxa, for accession numbers see the SSU tree) were selected for SSU phylogeny. Their alignment included 1,544 characters of which 657 characters were variable. Fig. 4 represents the phylogenetic tree reconstructed using this dataset. In this tree the new species has appeared as an independent lineage in a basal position to the Hoplolaimina
Figure 4:
Bayesian 50% majority rule consensus tree of

A number of 136 sequences (including the newly generated sequences and the sequences of outgroup taxa, for accession numbers see the LSU tree) were selected for LSU phylogeny. Their alignment included 506 characters of which 336 characters were variable. Fig. 5 represents the phylogenetic tree reconstructed using this dataset. In this tree, the new species is included in a clade encompassing representatives of
Figure 5:
Bayesian 50% majority rule consensus tree of

During the present study, a tylenchid nematode with didelphic-amphidelphic type of female reproduction system was recovered from undisturbed regions of one of Urmia Lake islands, northwest Iran. It had a Tylenchidae-type cloacal bursa and looked similar to the Psilenchidae members
The new species has similarities with
There is currently no general agreement on the taxonomy of Psilenchidae. The family concept as proposed by Siddiqi (2000) looks however more applicable in taxonomy of the didelphic Tylenchidae-like genera (named herein as psilenchs), as, they have phasmid, a key feature differentiating them from Tylenchidae. On the other hand, the phylogenetic inferences using SSU and LSU markers, further corroborate the affinity of the Psilenchidae members with Dolichodoroidea Chitwood and Chitwood in Chitwood, 1950
Figure S1:
The SSU tree inferred using the original data by Hosseinvand et al. (2020), the same alignment, postediting and inference methods; but using aphelenchs as outgroup taxa.

In presently inferred SSU phylogeny, psilenchs occupied basal position in relation to included Hoplolaimina, reminding ‘