Effect of no-tillage and tillage systems on melon (Cucumis melo L.) yield, nutrient uptake and microbial community structures in greenhouse soils
, , e
17 ott 2020
INFORMAZIONI SU QUESTO ARTICOLO
Categoria dell'articolo: Research Article
Pubblicato online: 17 ott 2020
Pagine: 265 - 278
Ricevuto: 23 giu 2020
Accettato: 04 set 2020
DOI: https://doi.org/10.2478/fhort-2020-0024
Parole chiave
© 2020 Jian Zhang et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Oligonucleotide primers for PCR
Microbes | Regions | Forward primer (5′-3′) | Reverse primer (5′-3′) |
---|---|---|---|
Bacteria | V4–V5 | GTGCCAGCMGCCGCGG | CCGTCAATTCMTTTRAGTTT |
Fungi | ITS1 | CTTGGTCATTTAGAGGAAGTAA | GCTGCGTTCTTCATCGATGC |
Soil microbial correlation with melon plant and nutrients
Microbial groups | Nutrients | Soil microbial genus | Correlation | Significant level | Plant part | |
---|---|---|---|---|---|---|
Bacteria | TN, TP and TK | Pirellula | 0.771 | 0.038 | Leaf and Fruit | |
TN | Dongia | −0.869 | 0.010 | Stem | ||
TN | Gemmatimonas, Hamadaea | −0.927 | 0.002 | Stem | ||
TP | Dongia | −0.811 | 0.024 | Stem | ||
TP | Nocardioides, Gemmatimonas | −0.753 | 0.044 | Stem | ||
TP | Planctomycetes | 0.927 | 0.002 | Stem | ||
TP | Armatimonadetes | −0.898 | 0.005 | Stem | ||
TP | Patescibacteria | −0.898 | 0.005 | Stem | ||
Fungi | TN, TP and TK | Chaetomium | −0.771 | 0.038 | Leaf and Fruit | |
TN, TP and TK | Dendrostilbella | 0.771 | 0.038 | Leaf and Fruit | ||
TN | AcrophialophoraCephaliophora | 0.782 | 0.034 | Stem | ||
TN | Polyschema | −0.898 | 0.005 | Stem | ||
TN | Cercospora | −0.788 | 0.032 | Stem | ||
TN | Scedosporium | 0.779 | 0.035 | Stem | ||
TN | Verticillium | −0.927 | 0.002 | Stem | ||
TP | Fusarium | −0.753 | 0.044 | Stem | ||
TP | Cercospora | −0.857 | 0.013 | Stem | ||
TK | Dendrostilbella | −0.771 | 0.038 | Stem | ||
TK | Ascobolus | −0.885 | 0.007 | Stem |
Basic properties of soils in two treatments
Treatment | pH | OM | TN | TP | TK | AN | AP | AK |
---|---|---|---|---|---|---|---|---|
g · kg−1 | mg · kg−1 | |||||||
UT | 7.30 ± 0.05 | 20.70 ± 0.08 | 1.07 ± 0.02 | 1.91 ± 0.04 | 6.34 ± 0.09 | 155.23 ± 3.21 | 89.42 ± 2.12 | 686.05 ± 3.14 |
TI | 7.12 ± 0.03 | 22.01 ± 0.11 | 1.18 ± 0.05 | 1.69 ± 0.07 | 5.81 ± 0.02 | 163.51 ± 1.51 | 95.61 ± 1.11 | 767.00 ± 1.89 |