Accès libre

Effect of no-tillage and tillage systems on melon (Cucumis melo L.) yield, nutrient uptake and microbial community structures in greenhouse soils

À propos de cet article

Citez

Figure 1

Nutrient uptake in melon plant's leaf, stem, and fruit and yield analysis. Differences were considered statistically significant and highly significant at p < 0.05 (*) and p < 0.01 (**), respectively. Abbreviations: TK, total potassium; TN, Total nitrogen; TP, total phosphorus. UT and TL present no-tillage and tillage treatments, respectively.
Nutrient uptake in melon plant's leaf, stem, and fruit and yield analysis. Differences were considered statistically significant and highly significant at p < 0.05 (*) and p < 0.01 (**), respectively. Abbreviations: TK, total potassium; TN, Total nitrogen; TP, total phosphorus. UT and TL present no-tillage and tillage treatments, respectively.

Figure 2

Microbial community bar plot with cluster tree. Relative abundances of bacterial (A) and fungal (B) phyla in soils under no-tillage and tillage treatments.
Microbial community bar plot with cluster tree. Relative abundances of bacterial (A) and fungal (B) phyla in soils under no-tillage and tillage treatments.

Figure 3

Bacterial community heatmap analysis at the genus level.
Bacterial community heatmap analysis at the genus level.

Figure 4

Fungal community heatmap analysis at the genus level.
Fungal community heatmap analysis at the genus level.

Figure 5

OTU Venn (A) and LEfSe (B) analyses of bacteria in no-tillage and tillage treatments.
OTU Venn (A) and LEfSe (B) analyses of bacteria in no-tillage and tillage treatments.

Figure 6

Redundancy analysis of bacterial (A) and fungal (B) communities in no-tillage and tillage soil samples; heatmap of correlations. * and ** means significant correlations at p < 0.05, and p ≤ 0.01, respectively. Abbreviations: AK, available K; AN, alkaline nitrogen; AP, available P; OM, organic matter.
Redundancy analysis of bacterial (A) and fungal (B) communities in no-tillage and tillage soil samples; heatmap of correlations. * and ** means significant correlations at p < 0.05, and p ≤ 0.01, respectively. Abbreviations: AK, available K; AN, alkaline nitrogen; AP, available P; OM, organic matter.

Figure 7

Biplot of species – environmental variables according to the CCA of bacterial taxa.
Biplot of species – environmental variables according to the CCA of bacterial taxa.

Figure 8

Biplot of species – environmental variables according to the CCA of fungal taxa.
Biplot of species – environmental variables according to the CCA of fungal taxa.

Oligonucleotide primers for PCR

MicrobesRegionsForward primer (5′-3′)Reverse primer (5′-3′)
BacteriaV4–V5GTGCCAGCMGCCGCGGCCGTCAATTCMTTTRAGTTT
FungiITS1CTTGGTCATTTAGAGGAAGTAAGCTGCGTTCTTCATCGATGC

Soil microbial correlation with melon plant and nutrients

Microbial groupsNutrientsSoil microbial genusCorrelationp-valueSignificant levelPlant part
BacteriaTN, TP and TKPirellula0.7710.038*Leaf and Fruit
TNDongia−0.8690.010*Stem
TNGemmatimonas, Hamadaea−0.9270.002**Stem
TPDongia−0.8110.024*Stem
TPNocardioides, Gemmatimonas−0.7530.044*Stem
TPPlanctomycetes0.9270.002**Stem
TPArmatimonadetes−0.8980.005**Stem
TPPatescibacteria−0.8980.005**Stem
FungiTN, TP and TKChaetomium−0.7710.038*Leaf and Fruit
TN, TP and TKDendrostilbella0.7710.038*Leaf and Fruit
TNAcrophialophoraCephaliophora0.7820.034*Stem
TNPolyschema−0.8980.005**Stem
TNCercospora−0.7880.032*Stem
TNScedosporium0.7790.035*Stem
TNVerticillium−0.9270.002**Stem
TPFusarium−0.7530.044*Stem
TPCercospora−0.8570.013*Stem
TKDendrostilbella−0.7710.038*Stem
TKAscobolus−0.8850.007**Stem

Basic properties of soils in two treatments

TreatmentpHOMTNTPTKANAPAK
g · kg−1mg · kg−1
UT7.30 ± 0.0520.70 ± 0.081.07 ± 0.021.91 ± 0.046.34 ± 0.09155.23 ± 3.2189.42 ± 2.12686.05 ± 3.14
TI7.12 ± 0.0322.01 ± 0.111.18 ± 0.051.69 ± 0.075.81 ± 0.02163.51 ± 1.5195.61 ± 1.11767.00 ± 1.89
eISSN:
2083-5965
Langue:
Anglais
Périodicité:
2 fois par an
Sujets de la revue:
Life Sciences, Plant Science, Zoology, Ecology, other