Accesso libero

qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells

Rut Bryl

Rut Bryl

Department of Anatomy, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Bryl, Rut
, 
Claudia Dompe

Claudia Dompe

School of Medicine, Medical Sciences and Nutrition, University of AberdeenAberdeen, UK
Cerca questo autore su
Sciendo|Google Scholar
Dompe, Claudia
, 
Maurycy Jankowski

Maurycy Jankowski

Department of Anatomy, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Jankowski, Maurycy
, 
Katarzyna Stefańska

Katarzyna Stefańska

Department of Histology and Embryology, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Stefańska, Katarzyna
, 
Afsaneh Golkar Narenji

Afsaneh Golkar Narenji

Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, USA
Cerca questo autore su
Sciendo|Google Scholar
Narenji, Afsaneh Golkar
, 
Jakub Kulus

Jakub Kulus

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Kulus, Jakub
, 
Magdalena Kulus

Magdalena Kulus

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Kulus, Magdalena
, 
Maria Wieczorkiewicz

Maria Wieczorkiewicz

Department of Basic and Preclinical Sciences, Institute of Veterinary Medicine, Faculty of Biological and Veterinary Sciences, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Wieczorkiewicz, Maria
, 
Grzegorz Wąsiatycz

Grzegorz Wąsiatycz

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Wąsiatycz, Grzegorz
, 
Jędrzej M. Jaśkowski

Jędrzej M. Jaśkowski

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Jaśkowski, Jędrzej M.
, 
Mariusz Kaczmarek

Mariusz Kaczmarek

Department of Cancer Immunology, Poznań University of Medical SciencesPoznań, Poland
Cerca questo autore su
Sciendo|Google Scholar
Kaczmarek, Mariusz
, 
James N. Petitte

James N. Petitte

Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, USA
Cerca questo autore su
Sciendo|Google Scholar
Petitte, James N.
, 
Paul Mozdziak

Paul Mozdziak

  • Prestage Department of Poultry Science, North Carolina State UniversityRaleigh, USA
  • Physiology Graduate Program, North Carolina State UniversityRaleigh, USA
Cerca questo autore su
Sciendo|Google Scholar
Mozdziak, Paul
, 
Paweł Antosik

Paweł Antosik

Department of Veterinary Surgery, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Antosik, Paweł
 e 
Dorota Bukowska

Dorota Bukowska

Department of Diagnostics and Clinical Sciences, Institute of Veterinary Medicine, Nicolaus Copernicus University in ToruńToruń, Poland
Cerca questo autore su
Sciendo|Google Scholar
Bukowska, Dorota
  
31 dic 2020
qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells's Cover Image
INFORMAZIONI SU QUESTO ARTICOLO
Articolo precedente
Articolo Successivo
Cita
Scarica la copertina
Pubblicato online: 31 dic 2020
Pagine: 139 - 145
Ricevuto: 12 ott 2020
Accettato: 15 nov 2020
DOI: https://doi.org/10.2478/acb-2020-0017
Parole chiave
© 2020 Rut Bryl, Claudia Dompe, Maurycy Jankowski, Katarzyna Stefańska, Afsaneh Golkar Narenji, Jakub Kulus, Magdalena Kulus, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Jędrzej M. Jaśkowski, Mariusz Kaczmarek, James N. Petitte, Paul Mozdziak, Paweł Antosik, Dorota Bukowska, published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Photographs of morphological changes between the beginning and end-point of in vitro culture. Taken using an inverted microscope, using a relief contrast and 10x magnification.
Photographs of morphological changes between the beginning and end-point of in vitro culture. Taken using an inverted microscope, using a relief contrast and 10x magnification.

Figure 2

The results of the flow cytometry analysis of the available canine ASC markers. The coloured peaks represent the cells stained by the specific antibodies, while the transparent peaks correspond to isotype controls.
The results of the flow cytometry analysis of the available canine ASC markers. The coloured peaks represent the cells stained by the specific antibodies, while the transparent peaks correspond to isotype controls.

Figure 3

The results of the RT-qPCR analysis of the change in expression of ASC specific markers during a 14-day primary culture of adipocyte derived stem cells. All data was presented as a log10 of fold change.
The results of the RT-qPCR analysis of the change in expression of ASC specific markers during a 14-day primary culture of adipocyte derived stem cells. All data was presented as a log10 of fold change.

The sequences of primers used in the analysis

GENE NAMEFORWARD PRIMERREVERSE PRIMER
CD105CTCAGGTCCCCAATGCTACCGGTTGAAGGCCAGGTAGAGT
CD73CCCATTGACGAACGGAACAATATACCACGTGAATTCCGCC
CD14CACTAGAGCCCTGCGAAGTACGACGGCAATCATACACTGG
CD34ATGAGACCTCCAGCTGTGAGAGGTCAGACTGGTGCTTTCT
CD90CGAGAATGCTACCACCTTGCAGCCGGAGTTCACATGTGTA
CD45ACCTAGGCAAACATGTGAGGACTTCCAGATCAAAATTTCCACGA
HPRTCCATCACATCGTAGCCCTCACTTTTATATCGCCCGTTGAC
ACTBCCCTTGCCGCTCCGCCTTCGCAGCAATATCGGTCATCCAT
Lingua:
Inglese
Frequenza di pubblicazione:
4 volte all'anno
Argomenti della rivista:
Scienze biologiche, Biologia molecolare, Buiochimica
Feed RSS della rivista