<abstract xmlns="http://www.w3.org/1999/xhtml"><p>Due to its availability and accessibility, adipose tissue has been the subject of various studies in many different medical fields and is believed to be a useful source of stem cells. The ability of ASCs to differentiate towards different cell lineages, with possibility of directing this differentiation, increases their possible clinical applications, and they have been widely employed in multiple therapies and treatment of different pathologies. However, a deeper understanding of the molecular mechanisms underlying the ASCs osteoblastic and chondrocyte differentiation may lead to novel applications treating a multitude of different bone-related diseases through techniques more likely meeting worldwide consensus. In this study, the RT-qPCR method was used to determine the changes in expression of ASC specific markers (CD105, CD73, CD14, CD34, CD90 and CD45) before and after long-term (14-day) <italic>in vitro</italic> cultures. To confirm the identity of the investigated cells, flow cytometry was used to evaluate the presence of positive (CD44, CD90) and negative (CD45, CD34) ASC markers. Overall, the results of the PCR analysis showed a significant change in expression of most of the marker genes, indicating significant changes in the cultured cells caused by their long-term culture, potentially altering their original stem-like characteristics.</p><p><bold>Running title</bold>: ASC marker expression during long-term <italic>in vitro</italic> culture</p></abstract>

Due to its availability and accessibility, adipose tissue has been the subject of various studies in many different medical fields and is believed to be a useful source of stem cells. The ability of ASCs to differentiate towards different cell lineages, with possibility of directing this differentiation, increases their possible clinical applications, and they have been widely employed in multiple therapies and treatment of different pathologies. However, a deeper understanding of the molecular mechanisms underlying the ASCs osteoblastic and chondrocyte differentiation may lead to novel applications treating a multitude of different bone-related diseases through techniques more likely meeting worldwide consensus. In this study, the RT-qPCR method was used to determine the changes in expression of ASC specific markers (CD105, CD73, CD14, CD34, CD90 and CD45) before and after long-term (14-day) in vitro cultures. To confirm the identity of the investigated cells, flow cytometry was used to evaluate the presence of positive (CD44, CD90) and negative (CD45, CD34) ASC markers. Overall, the results of the PCR analysis showed a significant change in expression of most of the marker genes, indicating significant changes in the cultured cells caused by their long-term culture, potentially altering their original stem-like characteristics.Running title: ASC marker expression during long-term in vitro culture

qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells

Medical Journal of Cell Biology

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Due to its availability and accessibility, adipose tissue has been the subject of various studies in many different medical fields and is believed to be a...

GENE NAME	FORWARD PRIMER	REVERSE PRIMER
CD105	CTCAGGTCCCCAATGCTACC	GGTTGAAGGCCAGGTAGAGT
CD73	CCCATTGACGAACGGAACAA	TATACCACGTGAATTCCGCC
CD14	CACTAGAGCCCTGCGAAGTA	CGACGGCAATCATACACTGG
CD34	ATGAGACCTCCAGCTGTGAG	AGGTCAGACTGGTGCTTTCT
CD90	CGAGAATGCTACCACCTTGC	AGCCGGAGTTCACATGTGTA
CD45	ACCTAGGCAAACATGTGAGGA	CTTCCAGATCAAAATTTCCACGA
HPRT	CCATCACATCGTAGCCCTC	ACTTTTATATCGCCCGTTGAC
ACTB	CCCTTGCCGCTCCGCCTTC	GCAGCAATATCGGTCATCCAT

qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells

Online veröffentlicht: 31. Dez. 2020

Seitenbereich: 139 - 145

Eingereicht: 12. Okt. 2020

Akzeptiert: 15. Nov. 2020

DOI: https://doi.org/10.2478/acb-2020-0017

Schlüsselwörter
adipose, stem cells, long-term, culture, markers

© 2020 Rut Bryl, Claudia Dompe, Maurycy Jankowski, Katarzyna Stefańska, Afsaneh Golkar Narenji, Jakub Kulus, Magdalena Kulus, Maria Wieczorkiewicz, Grzegorz Wąsiatycz, Jędrzej M. Jaśkowski, Mariusz Kaczmarek, James N. Petitte, Paul Mozdziak, Paweł Antosik, Dorota Bukowska, published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Figure 2

Figure 3

The sequences of primers used in the analysis

qPCR analysis of mesenchymal stem cell marker expression during the long-term culture of canine adipocyte derived stem cells

Online veröffentlicht: 31. Dez. 2020

Seitenbereich: 139 - 145

Eingereicht: 12. Okt. 2020

Akzeptiert: 15. Nov. 2020

DOI: https://doi.org/10.2478/acb-2020-0017

Schlüsselwörteradipose, stem cells, long-term, culture, markers

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Figure 1

Figure 2

Figure 3

The sequences of primers used in the analysis

Schlüsselwörter
adipose, stem cells, long-term, culture, markers