Accesso libero

First report of morphological and molecular characterization of Moroccan populations of Globodera pallida

INFORMAZIONI SU QUESTO ARTICOLO

Cita

Figure 1:

Sampled areas and regions infested with Globodera pallida in Morocco.
Sampled areas and regions infested with Globodera pallida in Morocco.

Figure 2:

Photomicrographs of morphological characterization of cyst, egg, and second-stage juvenile. A, B: Cyst of Globodera pallida, C: Vulva (v), anus (a), and cuticular ridges (r) of cyst, D, E: Stylet knob shape of J2, F: Juvenile tail.
Photomicrographs of morphological characterization of cyst, egg, and second-stage juvenile. A, B: Cyst of Globodera pallida, C: Vulva (v), anus (a), and cuticular ridges (r) of cyst, D, E: Stylet knob shape of J2, F: Juvenile tail.

Figure 3:

Amplified PCR products from Globodera spp. digested by three enzymes AluI, MboI, and RsaI. A: Amplified PCR products, B: AluI, C: RsaI, D: MboI, MW: molecular weight markers (1 kb), NC: negative control, PC: undigested DNA, S1-S2: Eastern region samples, S3-S4: Western region samples (Gharb), S5-S6: Doukkala region samples.
Amplified PCR products from Globodera spp. digested by three enzymes AluI, MboI, and RsaI. A: Amplified PCR products, B: AluI, C: RsaI, D: MboI, MW: molecular weight markers (1 kb), NC: negative control, PC: undigested DNA, S1-S2: Eastern region samples, S3-S4: Western region samples (Gharb), S5-S6: Doukkala region samples.

Primers used in the present study.

Primer name Nematode 5′-3′ Sequence Band size References
ITS5 Forward GGAAGTAAAAGTCGTAACAAGG White et al. (1990)
PITSp4 Globodera pallida ACAACAGCAATCGTCGAG 265 bp Bulman and Marshall (1997); Skantar et al. (2007)
PITSr3 Globodera rostochiensis AGCGCAGACATGCCGCAA 434 bp

Morphological and morphometric characteristics of Moroccan population of cysts and second-stage juveniles compared to the standard Globodera pallida (EPPO, 2004).

Species Shape of knob J2 stylet length (µm) Number of cuticula ridges Granek’s ratio
G. rostochiensisa Rounded (21.8) 16-31 (>14) 1.3-9.5 (>3)
G. pallida a Pointed 22-24 (23.8) 8-20 (<14) 1.2-3.5 (<3)
Moroccan population G. pallida Pointed 22.6 9 2.2
eISSN:
2640-396X
Lingua:
Inglese
Frequenza di pubblicazione:
Volume Open
Argomenti della rivista:
Life Sciences, other